Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636247_at:

>probe:Drosophila_2:1636247_at:166:487; Interrogation_Position=1746; Antisense; GTACTCGGGCGGATCTGGAACAGCA
>probe:Drosophila_2:1636247_at:301:597; Interrogation_Position=1776; Antisense; TGTGCGGCTCGGATGGCAACACCTT
>probe:Drosophila_2:1636247_at:219:517; Interrogation_Position=1844; Antisense; GTGGTGCCCGTTTCGCTAAAGAATT
>probe:Drosophila_2:1636247_at:170:209; Interrogation_Position=1862; Antisense; AAGAATTGCGCTTTAACCGCCGACT
>probe:Drosophila_2:1636247_at:147:325; Interrogation_Position=1887; Antisense; GCGAATCGGATTGTGATGCCCAGCC
>probe:Drosophila_2:1636247_at:122:253; Interrogation_Position=1914; Antisense; CAAGTTTCGTCTGCGGATCGGACAA
>probe:Drosophila_2:1636247_at:503:727; Interrogation_Position=1943; Antisense; TTGTACAAGTCCGAGTGCCACATGC
>probe:Drosophila_2:1636247_at:125:209; Interrogation_Position=1985; Antisense; AAGCATGTTTTCGTGGTGCCACTGA
>probe:Drosophila_2:1636247_at:705:341; Interrogation_Position=2032; Antisense; GCTTAAAGGATGTGCCCGCATCTGT
>probe:Drosophila_2:1636247_at:204:247; Interrogation_Position=2064; Antisense; AATTCGAGCCTGTTTGCGGCAGCGA
>probe:Drosophila_2:1636247_at:350:685; Interrogation_Position=2099; Antisense; TATCTGAACGACTGCTTCCTGGAGA
>probe:Drosophila_2:1636247_at:478:509; Interrogation_Position=2150; Antisense; GTGAACGTCAACTACTACGGCGCCT
>probe:Drosophila_2:1636247_at:232:137; Interrogation_Position=2217; Antisense; ACGTATGTATGCGTGGCGTCTTCAT
>probe:Drosophila_2:1636247_at:2:521; Interrogation_Position=2229; Antisense; GTGGCGTCTTCATTTCACTTGGCAT

Paste this into a BLAST search page for me
GTACTCGGGCGGATCTGGAACAGCATGTGCGGCTCGGATGGCAACACCTTGTGGTGCCCGTTTCGCTAAAGAATTAAGAATTGCGCTTTAACCGCCGACTGCGAATCGGATTGTGATGCCCAGCCCAAGTTTCGTCTGCGGATCGGACAATTGTACAAGTCCGAGTGCCACATGCAAGCATGTTTTCGTGGTGCCACTGAGCTTAAAGGATGTGCCCGCATCTGTAATTCGAGCCTGTTTGCGGCAGCGATATCTGAACGACTGCTTCCTGGAGAGTGAACGTCAACTACTACGGCGCCTACGTATGTATGCGTGGCGTCTTCATGTGGCGTCTTCATTTCACTTGGCAT

Full Affymetrix probeset data:

Annotations for 1636247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime