FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636248_at:

>probe:Drosophila_2:1636248_at:299:85; Interrogation_Position=3025; Antisense; AGTGAGCTCCAAGAACGAGCAGAGA
>probe:Drosophila_2:1636248_at:520:653; Interrogation_Position=3087; Antisense; TCAAGGAGCGCATCAATTTATTAAA
>probe:Drosophila_2:1636248_at:2:109; Interrogation_Position=3162; Antisense; AGCAACATACACCAACTACTTCTCT
>probe:Drosophila_2:1636248_at:494:583; Interrogation_Position=3191; Antisense; TGGCTCGCCACGCAAAATCTCTGAA
>probe:Drosophila_2:1636248_at:463:39; Interrogation_Position=3207; Antisense; ATCTCTGAACAGGATAATCTCGAAT
>probe:Drosophila_2:1636248_at:240:137; Interrogation_Position=3263; Antisense; ACGAAAATCTCTCGCTTGGGCCATG
>probe:Drosophila_2:1636248_at:338:595; Interrogation_Position=3279; Antisense; TGGGCCATGGAACAGAGCTATGCAC
>probe:Drosophila_2:1636248_at:649:117; Interrogation_Position=3294; Antisense; AGCTATGCACAATTTCCTCTATTTA
>probe:Drosophila_2:1636248_at:302:379; Interrogation_Position=3321; Antisense; GAAGCCGTTTCAGAATACTACATAT
>probe:Drosophila_2:1636248_at:9:723; Interrogation_Position=3365; Antisense; TTGAATACTTTCGATGACCCAAACG
>probe:Drosophila_2:1636248_at:203:695; Interrogation_Position=3373; Antisense; TTTCGATGACCCAAACGAAGTGCTT
>probe:Drosophila_2:1636248_at:629:335; Interrogation_Position=3394; Antisense; GCTTTGATTTTAAATGGTCGCGTAC
>probe:Drosophila_2:1636248_at:190:535; Interrogation_Position=3409; Antisense; GGTCGCGTACCAACCAAACATATTT
>probe:Drosophila_2:1636248_at:505:265; Interrogation_Position=3468; Antisense; CATATAAACCCAAAACCCCATGAAG

Paste this into a BLAST search page for me
AGTGAGCTCCAAGAACGAGCAGAGATCAAGGAGCGCATCAATTTATTAAAAGCAACATACACCAACTACTTCTCTTGGCTCGCCACGCAAAATCTCTGAAATCTCTGAACAGGATAATCTCGAATACGAAAATCTCTCGCTTGGGCCATGTGGGCCATGGAACAGAGCTATGCACAGCTATGCACAATTTCCTCTATTTAGAAGCCGTTTCAGAATACTACATATTTGAATACTTTCGATGACCCAAACGTTTCGATGACCCAAACGAAGTGCTTGCTTTGATTTTAAATGGTCGCGTACGGTCGCGTACCAACCAAACATATTTCATATAAACCCAAAACCCCATGAAG

Full Affymetrix probeset data:

Annotations for 1636248_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720