Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636249_at:

>probe:Drosophila_2:1636249_at:490:259; Interrogation_Position=1033; Antisense; CACGACGTTTCCATATGGGTGTCTA
>probe:Drosophila_2:1636249_at:376:119; Interrogation_Position=1075; Antisense; AGCTGGTTATCAATGTTGTCCCGCA
>probe:Drosophila_2:1636249_at:559:501; Interrogation_Position=1092; Antisense; GTCCCGCAAGCGATGTCTAGTAATG
>probe:Drosophila_2:1636249_at:126:477; Interrogation_Position=1141; Antisense; GTTATTCGTATAGTACCAGGGCTCT
>probe:Drosophila_2:1636249_at:227:25; Interrogation_Position=587; Antisense; ATAGTGAAGAACGACGCCGGCCTGC
>probe:Drosophila_2:1636249_at:567:625; Interrogation_Position=638; Antisense; TGCCCTGAGGGCTACGACATGGAGA
>probe:Drosophila_2:1636249_at:61:569; Interrogation_Position=671; Antisense; GGCAGCTGCATTGTCGACTTCGAAA
>probe:Drosophila_2:1636249_at:544:399; Interrogation_Position=686; Antisense; GACTTCGAAAACACGGCCATCTTCA
>probe:Drosophila_2:1636249_at:247:407; Interrogation_Position=734; Antisense; GACTGTACCTGCGACAACGAGCATA
>probe:Drosophila_2:1636249_at:280:223; Interrogation_Position=803; Antisense; AAGGGTGACCTGAACTCCGCCGTGG
>probe:Drosophila_2:1636249_at:338:613; Interrogation_Position=864; Antisense; TGAACAACGTTAACAGCCTGGCTAA
>probe:Drosophila_2:1636249_at:564:69; Interrogation_Position=891; Antisense; AGGCCGGATATCCTGTGATGCCCGA
>probe:Drosophila_2:1636249_at:687:639; Interrogation_Position=919; Antisense; TCGGCTGGACGACGCGGTCATAAAC
>probe:Drosophila_2:1636249_at:504:7; Interrogation_Position=997; Antisense; ATTCCACTAAGGTAACTCGCTGATA

Paste this into a BLAST search page for me
CACGACGTTTCCATATGGGTGTCTAAGCTGGTTATCAATGTTGTCCCGCAGTCCCGCAAGCGATGTCTAGTAATGGTTATTCGTATAGTACCAGGGCTCTATAGTGAAGAACGACGCCGGCCTGCTGCCCTGAGGGCTACGACATGGAGAGGCAGCTGCATTGTCGACTTCGAAAGACTTCGAAAACACGGCCATCTTCAGACTGTACCTGCGACAACGAGCATAAAGGGTGACCTGAACTCCGCCGTGGTGAACAACGTTAACAGCCTGGCTAAAGGCCGGATATCCTGTGATGCCCGATCGGCTGGACGACGCGGTCATAAACATTCCACTAAGGTAACTCGCTGATA

Full Affymetrix probeset data:

Annotations for 1636249_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime