Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636251_at:

>probe:Drosophila_2:1636251_at:539:419; Interrogation_Position=3613; Antisense; GAGCAGCTACAAGTACTACGTGGTG
>probe:Drosophila_2:1636251_at:611:369; Interrogation_Position=3646; Antisense; GAAGGGCACCCAAACCTACTGGGAG
>probe:Drosophila_2:1636251_at:210:291; Interrogation_Position=3699; Antisense; CGGGCATCCAGATCAAGCTGGTCAA
>probe:Drosophila_2:1636251_at:654:535; Interrogation_Position=3734; Antisense; GGTCCGGGCCCAATGATGAGGAACA
>probe:Drosophila_2:1636251_at:429:187; Interrogation_Position=3755; Antisense; AACAGCCTGTGGCACGAGGGAAACA
>probe:Drosophila_2:1636251_at:302:157; Interrogation_Position=3777; Antisense; ACACCGACGGTGAGGCCAGGCTGCT
>probe:Drosophila_2:1636251_at:579:305; Interrogation_Position=3792; Antisense; CCAGGCTGCTGTGGAAGGATCCGAA
>probe:Drosophila_2:1636251_at:447:371; Interrogation_Position=3829; Antisense; GAAGGAAAGGACCTCCTACCGCTGG
>probe:Drosophila_2:1636251_at:254:647; Interrogation_Position=3882; Antisense; TCATCCGCCTGCAAATGCACGAGGG
>probe:Drosophila_2:1636251_at:496:231; Interrogation_Position=3895; Antisense; AATGCACGAGGGTAACCGCCTGATC
>probe:Drosophila_2:1636251_at:453:285; Interrogation_Position=3914; Antisense; CTGATCTTCGACTCGGGCAATGTGT
>probe:Drosophila_2:1636251_at:681:361; Interrogation_Position=3930; Antisense; GCAATGTGTTTGACTCCACGCTGAA
>probe:Drosophila_2:1636251_at:57:329; Interrogation_Position=3969; Antisense; GCGTGTTCTGCTTCTCACAGAGGAT
>probe:Drosophila_2:1636251_at:473:681; Interrogation_Position=3999; Antisense; TATGGTCCAACCTGCAGTACAAGTG

Paste this into a BLAST search page for me
GAGCAGCTACAAGTACTACGTGGTGGAAGGGCACCCAAACCTACTGGGAGCGGGCATCCAGATCAAGCTGGTCAAGGTCCGGGCCCAATGATGAGGAACAAACAGCCTGTGGCACGAGGGAAACAACACCGACGGTGAGGCCAGGCTGCTCCAGGCTGCTGTGGAAGGATCCGAAGAAGGAAAGGACCTCCTACCGCTGGTCATCCGCCTGCAAATGCACGAGGGAATGCACGAGGGTAACCGCCTGATCCTGATCTTCGACTCGGGCAATGTGTGCAATGTGTTTGACTCCACGCTGAAGCGTGTTCTGCTTCTCACAGAGGATTATGGTCCAACCTGCAGTACAAGTG

Full Affymetrix probeset data:

Annotations for 1636251_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime