Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636256_s_at:

>probe:Drosophila_2:1636256_s_at:357:525; Interrogation_Position=122; Antisense; GGGCTTCTTCATCGACAACTGAAGC
>probe:Drosophila_2:1636256_s_at:26:399; Interrogation_Position=135; Antisense; GACAACTGAAGCTTCATTGAATACG
>probe:Drosophila_2:1636256_s_at:722:363; Interrogation_Position=153; Antisense; GAATACGATAAATGTGACTACCCAG
>probe:Drosophila_2:1636256_s_at:412:61; Interrogation_Position=164; Antisense; ATGTGACTACCCAGAAGAAGCGTTC
>probe:Drosophila_2:1636256_s_at:303:211; Interrogation_Position=178; Antisense; AAGAAGCGTTCGCAGTTCCAGCGCA
>probe:Drosophila_2:1636256_s_at:343:351; Interrogation_Position=189; Antisense; GCAGTTCCAGCGCATTTATGAGAAA
>probe:Drosophila_2:1636256_s_at:467:681; Interrogation_Position=205; Antisense; TATGAGAAACTAGAGGACCTGGAAA
>probe:Drosophila_2:1636256_s_at:21:227; Interrogation_Position=228; Antisense; AAGGCAGATGGATCAGTATGAGCAA
>probe:Drosophila_2:1636256_s_at:665:55; Interrogation_Position=257; Antisense; ATGAGCTATTCATTCATCTACTGGC
>probe:Drosophila_2:1636256_s_at:21:713; Interrogation_Position=265; Antisense; TTCATTCATCTACTGGCTACAATCC
>probe:Drosophila_2:1636256_s_at:517:47; Interrogation_Position=41; Antisense; ATCCAATTGGAAACAACGAGTCTTT
>probe:Drosophila_2:1636256_s_at:426:431; Interrogation_Position=58; Antisense; GAGTCTTTGATGACAGAGGATCCTG
>probe:Drosophila_2:1636256_s_at:439:631; Interrogation_Position=78; Antisense; TCCTGAGCAGCCGAGTGGATCGAAG
>probe:Drosophila_2:1636256_s_at:122:43; Interrogation_Position=96; Antisense; ATCGAAGGAGGGTTCGCAGTCCTCA

Paste this into a BLAST search page for me
GGGCTTCTTCATCGACAACTGAAGCGACAACTGAAGCTTCATTGAATACGGAATACGATAAATGTGACTACCCAGATGTGACTACCCAGAAGAAGCGTTCAAGAAGCGTTCGCAGTTCCAGCGCAGCAGTTCCAGCGCATTTATGAGAAATATGAGAAACTAGAGGACCTGGAAAAAGGCAGATGGATCAGTATGAGCAAATGAGCTATTCATTCATCTACTGGCTTCATTCATCTACTGGCTACAATCCATCCAATTGGAAACAACGAGTCTTTGAGTCTTTGATGACAGAGGATCCTGTCCTGAGCAGCCGAGTGGATCGAAGATCGAAGGAGGGTTCGCAGTCCTCA

Full Affymetrix probeset data:

Annotations for 1636256_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime