FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636257_at:

>probe:Drosophila_2:1636257_at:433:479; Interrogation_Position=388; Antisense; GTTTCATCAACTTTGTGCTGCGCTA
>probe:Drosophila_2:1636257_at:176:685; Interrogation_Position=411; Antisense; TATCTGTCCGAACTGGATGTGCCCA
>probe:Drosophila_2:1636257_at:720:525; Interrogation_Position=443; Antisense; GGGCACCTTTATCGAATTCCGGAAT
>probe:Drosophila_2:1636257_at:295:55; Interrogation_Position=474; Antisense; ATGAACGTTTGTCCCATTGGCAGGC
>probe:Drosophila_2:1636257_at:251:189; Interrogation_Position=519; Antisense; AACATGTTCGCCGAGTACGACATTG
>probe:Drosophila_2:1636257_at:619:429; Interrogation_Position=585; Antisense; GAGTTTGCCGATGTGGATCTCACGT
>probe:Drosophila_2:1636257_at:570:449; Interrogation_Position=600; Antisense; GATCTCACGTACTCGATTGGTGGTC
>probe:Drosophila_2:1636257_at:350:591; Interrogation_Position=620; Antisense; TGGTCAGATCAGCTTCGATGTCTTC
>probe:Drosophila_2:1636257_at:471:59; Interrogation_Position=637; Antisense; ATGTCTTCCCGCATGGTTGGGACAA
>probe:Drosophila_2:1636257_at:476:593; Interrogation_Position=654; Antisense; TGGGACAAGACCTACTGCCTGCGAC
>probe:Drosophila_2:1636257_at:551:225; Interrogation_Position=702; Antisense; AAGGAAATCCACTTCTTTGGCGATA
>probe:Drosophila_2:1636257_at:415:125; Interrogation_Position=733; Antisense; AGCCGGGCGGCAATGACTATGAGAT
>probe:Drosophila_2:1636257_at:330:633; Interrogation_Position=794; Antisense; TACTCCCAAGGATACGCAACGCATT
>probe:Drosophila_2:1636257_at:662:11; Interrogation_Position=816; Antisense; ATTCTCACCGAGATTCTGGAGCTGT

Paste this into a BLAST search page for me
GTTTCATCAACTTTGTGCTGCGCTATATCTGTCCGAACTGGATGTGCCCAGGGCACCTTTATCGAATTCCGGAATATGAACGTTTGTCCCATTGGCAGGCAACATGTTCGCCGAGTACGACATTGGAGTTTGCCGATGTGGATCTCACGTGATCTCACGTACTCGATTGGTGGTCTGGTCAGATCAGCTTCGATGTCTTCATGTCTTCCCGCATGGTTGGGACAATGGGACAAGACCTACTGCCTGCGACAAGGAAATCCACTTCTTTGGCGATAAGCCGGGCGGCAATGACTATGAGATTACTCCCAAGGATACGCAACGCATTATTCTCACCGAGATTCTGGAGCTGT

Full Affymetrix probeset data:

Annotations for 1636257_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720