FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636258_at:

>probe:Drosophila_2:1636258_at:645:385; Interrogation_Position=1338; Antisense; GAACACCATTACTGTTCCCATGGAA
>probe:Drosophila_2:1636258_at:297:269; Interrogation_Position=1356; Antisense; CATGGAATTTTTGCAGTGGCCCTTG
>probe:Drosophila_2:1636258_at:707:521; Interrogation_Position=1371; Antisense; GTGGCCCTTGTTCGATCACCGAGAG
>probe:Drosophila_2:1636258_at:627:137; Interrogation_Position=1439; Antisense; ACGAGATGAACCACGCCTTTGAACA
>probe:Drosophila_2:1636258_at:310:77; Interrogation_Position=1467; Antisense; AGGTATACTCTTCGATGCAGCTGGA
>probe:Drosophila_2:1636258_at:2:609; Interrogation_Position=1494; Antisense; TGAGTCACCTGTGGGCTTGGAGATC
>probe:Drosophila_2:1636258_at:665:363; Interrogation_Position=1513; Antisense; GAGATCCGGGAGTCGAAGCCTTTTC
>probe:Drosophila_2:1636258_at:558:203; Interrogation_Position=1528; Antisense; AAGCCTTTTCGGGATGCCATCAAGT
>probe:Drosophila_2:1636258_at:652:359; Interrogation_Position=1563; Antisense; GCAACCATTCGTCTCGCTGAAAGAA
>probe:Drosophila_2:1636258_at:710:227; Interrogation_Position=1603; Antisense; AATGGCCTGCAACTGGCGTACGATG
>probe:Drosophila_2:1636258_at:156:489; Interrogation_Position=1620; Antisense; GTACGATGCCTTCTTTGGCTTGGCC
>probe:Drosophila_2:1636258_at:320:241; Interrogation_Position=1664; Antisense; AATACCGTCCATATGCCTTTGAGCA
>probe:Drosophila_2:1636258_at:471:601; Interrogation_Position=1709; Antisense; TGTTTCACCTTAGCTACGCACAGTT
>probe:Drosophila_2:1636258_at:81:711; Interrogation_Position=1828; Antisense; TTCAATTGCGAAACGAGTCCCTCGT

Paste this into a BLAST search page for me
GAACACCATTACTGTTCCCATGGAACATGGAATTTTTGCAGTGGCCCTTGGTGGCCCTTGTTCGATCACCGAGAGACGAGATGAACCACGCCTTTGAACAAGGTATACTCTTCGATGCAGCTGGATGAGTCACCTGTGGGCTTGGAGATCGAGATCCGGGAGTCGAAGCCTTTTCAAGCCTTTTCGGGATGCCATCAAGTGCAACCATTCGTCTCGCTGAAAGAAAATGGCCTGCAACTGGCGTACGATGGTACGATGCCTTCTTTGGCTTGGCCAATACCGTCCATATGCCTTTGAGCATGTTTCACCTTAGCTACGCACAGTTTTCAATTGCGAAACGAGTCCCTCGT

Full Affymetrix probeset data:

Annotations for 1636258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720