Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636259_s_at:

>probe:Drosophila_2:1636259_s_at:33:659; Interrogation_Position=131; Antisense; TAACGTCCACGCGTTCTAGAACATA
>probe:Drosophila_2:1636259_s_at:342:455; Interrogation_Position=162; Antisense; GATAATCTTCATGCATCACTCCAAC
>probe:Drosophila_2:1636259_s_at:411:467; Interrogation_Position=231; Antisense; GTTGTTGCTGTTGCACCGGAAGCAT
>probe:Drosophila_2:1636259_s_at:545:377; Interrogation_Position=249; Antisense; GAAGCATTTTATTGCCCGTTCGCGA
>probe:Drosophila_2:1636259_s_at:274:11; Interrogation_Position=273; Antisense; ATTCGCCTGCGCTGATTATACTGGG
>probe:Drosophila_2:1636259_s_at:424:361; Interrogation_Position=298; Antisense; GCAATCGTAAATCCCGCTTTTGTGG
>probe:Drosophila_2:1636259_s_at:628:133; Interrogation_Position=328; Antisense; ACGCGCGATCTTGCAACAGTTGCTG
>probe:Drosophila_2:1636259_s_at:166:395; Interrogation_Position=392; Antisense; GAAATGGCAAAACGCCCGCTGGCAT
>probe:Drosophila_2:1636259_s_at:678:579; Interrogation_Position=437; Antisense; GGCCAGCCCCGAACATTAGATGATG
>probe:Drosophila_2:1636259_s_at:179:445; Interrogation_Position=455; Antisense; GATGATGTTGCCACAGATCGCGCAG
>probe:Drosophila_2:1636259_s_at:281:97; Interrogation_Position=469; Antisense; AGATCGCGCAGGTCAACAGCAGCAG
>probe:Drosophila_2:1636259_s_at:674:247; Interrogation_Position=512; Antisense; CAATCCGAACGTGTTGCTGATACAA
>probe:Drosophila_2:1636259_s_at:376:71; Interrogation_Position=547; Antisense; AGGCGCACATTTTTACGCTTCAGCG
>probe:Drosophila_2:1636259_s_at:24:281; Interrogation_Position=575; Antisense; CTCAACTCGTGCTATCTGTGCGAAA

Paste this into a BLAST search page for me
TAACGTCCACGCGTTCTAGAACATAGATAATCTTCATGCATCACTCCAACGTTGTTGCTGTTGCACCGGAAGCATGAAGCATTTTATTGCCCGTTCGCGAATTCGCCTGCGCTGATTATACTGGGGCAATCGTAAATCCCGCTTTTGTGGACGCGCGATCTTGCAACAGTTGCTGGAAATGGCAAAACGCCCGCTGGCATGGCCAGCCCCGAACATTAGATGATGGATGATGTTGCCACAGATCGCGCAGAGATCGCGCAGGTCAACAGCAGCAGCAATCCGAACGTGTTGCTGATACAAAGGCGCACATTTTTACGCTTCAGCGCTCAACTCGTGCTATCTGTGCGAAA

Full Affymetrix probeset data:

Annotations for 1636259_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime