FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636262_at:

>probe:Drosophila_2:1636262_at:714:181; Interrogation_Position=1054; Antisense; AAAACTTCCCTCCAGATGGTGTAGC
>probe:Drosophila_2:1636262_at:463:349; Interrogation_Position=1101; Antisense; GCAGTGCATCTTCGATATATCGCGT
>probe:Drosophila_2:1636262_at:454:281; Interrogation_Position=596; Antisense; CTCGACTTGTGGTTTGCAGTGCCTT
>probe:Drosophila_2:1636262_at:597:85; Interrogation_Position=613; Antisense; AGTGCCTTGGGCGACATAAGCTTTA
>probe:Drosophila_2:1636262_at:164:565; Interrogation_Position=655; Antisense; GGAATCAGTCGTCCCGTAGATCATG
>probe:Drosophila_2:1636262_at:444:677; Interrogation_Position=671; Antisense; TAGATCATGGGCTCGTCCAGCAGGC
>probe:Drosophila_2:1636262_at:236:629; Interrogation_Position=686; Antisense; TCCAGCAGGCTATCGTTCAGTTGGC
>probe:Drosophila_2:1636262_at:367:23; Interrogation_Position=715; Antisense; ATATCTGCCAGCAAATCACACTCTG
>probe:Drosophila_2:1636262_at:303:241; Interrogation_Position=782; Antisense; AATACCAGCTCCAAAGGTCACTTTC
>probe:Drosophila_2:1636262_at:659:215; Interrogation_Position=811; Antisense; AAGATTCGCCTCTTGGAAGTGTCGC
>probe:Drosophila_2:1636262_at:248:545; Interrogation_Position=846; Antisense; GGATCGCCGATTGCAGGAAGCCCTA
>probe:Drosophila_2:1636262_at:360:221; Interrogation_Position=896; Antisense; AAGTGTCCGAACTTAAGCGCCAAAT
>probe:Drosophila_2:1636262_at:95:249; Interrogation_Position=936; Antisense; CAATATGCCCAGTTGCGCTGTTAAA
>probe:Drosophila_2:1636262_at:278:333; Interrogation_Position=952; Antisense; GCTGTTAAACGTCAGGCTGTCGCCA

Paste this into a BLAST search page for me
AAAACTTCCCTCCAGATGGTGTAGCGCAGTGCATCTTCGATATATCGCGTCTCGACTTGTGGTTTGCAGTGCCTTAGTGCCTTGGGCGACATAAGCTTTAGGAATCAGTCGTCCCGTAGATCATGTAGATCATGGGCTCGTCCAGCAGGCTCCAGCAGGCTATCGTTCAGTTGGCATATCTGCCAGCAAATCACACTCTGAATACCAGCTCCAAAGGTCACTTTCAAGATTCGCCTCTTGGAAGTGTCGCGGATCGCCGATTGCAGGAAGCCCTAAAGTGTCCGAACTTAAGCGCCAAATCAATATGCCCAGTTGCGCTGTTAAAGCTGTTAAACGTCAGGCTGTCGCCA

Full Affymetrix probeset data:

Annotations for 1636262_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720