FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636264_at:

>probe:Drosophila_2:1636264_at:330:85; Interrogation_Position=6560; Antisense; AGTGCTATGCATATCAAAACGAACG
>probe:Drosophila_2:1636264_at:354:443; Interrogation_Position=6595; Antisense; GATGTTCGATGACTTAATATGGCTA
>probe:Drosophila_2:1636264_at:247:267; Interrogation_Position=6671; Antisense; CAGGAACTGCCTCGAAAACCAAACA
>probe:Drosophila_2:1636264_at:121:189; Interrogation_Position=6692; Antisense; AACACCATTCAAGTTCGGATCGATG
>probe:Drosophila_2:1636264_at:458:451; Interrogation_Position=6709; Antisense; GATCGATGTTTGTATATTTTCCTTA
>probe:Drosophila_2:1636264_at:673:691; Interrogation_Position=6726; Antisense; TTTCCTTAAGATTCATTCACGGCAT
>probe:Drosophila_2:1636264_at:522:647; Interrogation_Position=6742; Antisense; TCACGGCATAAGTCGGCAAAAATTG
>probe:Drosophila_2:1636264_at:4:585; Interrogation_Position=6788; Antisense; TGGCATTTGCCGGATTTGTTCAAGG
>probe:Drosophila_2:1636264_at:441:389; Interrogation_Position=6827; Antisense; GAAAACTCGCACACATGACTCTATA
>probe:Drosophila_2:1636264_at:407:177; Interrogation_Position=6851; Antisense; AAACGTATTTGAACTGCATCGAAGA
>probe:Drosophila_2:1636264_at:162:421; Interrogation_Position=6878; Antisense; GAGAATTCCAAATGGCAGTTGCCTG
>probe:Drosophila_2:1636264_at:339:469; Interrogation_Position=6895; Antisense; GTTGCCTGCTTTCGGCTATTGGAAA
>probe:Drosophila_2:1636264_at:726:673; Interrogation_Position=6958; Antisense; TATAACCGAACGTACATTAAAGCAT
>probe:Drosophila_2:1636264_at:27:273; Interrogation_Position=7019; Antisense; CATTATTACAGAGCGACACACCCAA

Paste this into a BLAST search page for me
AGTGCTATGCATATCAAAACGAACGGATGTTCGATGACTTAATATGGCTACAGGAACTGCCTCGAAAACCAAACAAACACCATTCAAGTTCGGATCGATGGATCGATGTTTGTATATTTTCCTTATTTCCTTAAGATTCATTCACGGCATTCACGGCATAAGTCGGCAAAAATTGTGGCATTTGCCGGATTTGTTCAAGGGAAAACTCGCACACATGACTCTATAAAACGTATTTGAACTGCATCGAAGAGAGAATTCCAAATGGCAGTTGCCTGGTTGCCTGCTTTCGGCTATTGGAAATATAACCGAACGTACATTAAAGCATCATTATTACAGAGCGACACACCCAA

Full Affymetrix probeset data:

Annotations for 1636264_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720