FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636266_at:

>probe:Drosophila_2:1636266_at:406:371; Interrogation_Position=1102; Antisense; GAACTCCAAGTTCTTTGTCGCCGGT
>probe:Drosophila_2:1636266_at:196:521; Interrogation_Position=1130; Antisense; GGCGTCCTAAATGTAACCACTCGGG
>probe:Drosophila_2:1636266_at:17:453; Interrogation_Position=1158; Antisense; GATCTAAGATCCTGTTGCGCGCTGG
>probe:Drosophila_2:1636266_at:445:535; Interrogation_Position=1192; Antisense; GGTGCCTCTGGACCAATGCAATATA
>probe:Drosophila_2:1636266_at:21:243; Interrogation_Position=1211; Antisense; AATATATCCTATGCGGAGCAGCCCG
>probe:Drosophila_2:1636266_at:312:321; Interrogation_Position=1231; Antisense; GCCCGGTTCCATAAGGTTGCTCAAG
>probe:Drosophila_2:1636266_at:29:607; Interrogation_Position=1263; Antisense; TGATCGATTCGTTGCTGTGCGCCAT
>probe:Drosophila_2:1636266_at:164:725; Interrogation_Position=1287; Antisense; TTGATCAAAAGCTCATCGCCGACGC
>probe:Drosophila_2:1636266_at:694:587; Interrogation_Position=1356; Antisense; TGGAGGACGGCATGTACACCATCAT
>probe:Drosophila_2:1636266_at:197:37; Interrogation_Position=1376; Antisense; ATCATGGGCGTCATCTCGTCGGGAT
>probe:Drosophila_2:1636266_at:115:715; Interrogation_Position=1470; Antisense; TTGTCTGGCCGGACAATCGGGTGTA
>probe:Drosophila_2:1636266_at:281:75; Interrogation_Position=1554; Antisense; AGGACTGCCTGATCCATCGCAATTG
>probe:Drosophila_2:1636266_at:727:39; Interrogation_Position=1589; Antisense; ATCTGTGATCTCTATGAGCACCGCG
>probe:Drosophila_2:1636266_at:266:421; Interrogation_Position=1604; Antisense; GAGCACCGCGATCGAACCATTTAAT

Paste this into a BLAST search page for me
GAACTCCAAGTTCTTTGTCGCCGGTGGCGTCCTAAATGTAACCACTCGGGGATCTAAGATCCTGTTGCGCGCTGGGGTGCCTCTGGACCAATGCAATATAAATATATCCTATGCGGAGCAGCCCGGCCCGGTTCCATAAGGTTGCTCAAGTGATCGATTCGTTGCTGTGCGCCATTTGATCAAAAGCTCATCGCCGACGCTGGAGGACGGCATGTACACCATCATATCATGGGCGTCATCTCGTCGGGATTTGTCTGGCCGGACAATCGGGTGTAAGGACTGCCTGATCCATCGCAATTGATCTGTGATCTCTATGAGCACCGCGGAGCACCGCGATCGAACCATTTAAT

Full Affymetrix probeset data:

Annotations for 1636266_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720