FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636267_at:

>probe:Drosophila_2:1636267_at:474:109; Interrogation_Position=128; Antisense; AGAAGATGTACAACCTCAGGCCGGA
>probe:Drosophila_2:1636267_at:357:55; Interrogation_Position=13; Antisense; ATGAACCGCCAGCTGGCTAAGATAG
>probe:Drosophila_2:1636267_at:287:549; Interrogation_Position=150; Antisense; GGAGGCTGAGATGACCCTGTCCAAG
>probe:Drosophila_2:1636267_at:599:609; Interrogation_Position=161; Antisense; TGACCCTGTCCAAGATCCTGGAGAA
>probe:Drosophila_2:1636267_at:249:385; Interrogation_Position=183; Antisense; GAACTTCAAGCTGCTCATGTCTAGC
>probe:Drosophila_2:1636267_at:30:647; Interrogation_Position=197; Antisense; TCATGTCTAGCAGTGACCAGCGGGA
>probe:Drosophila_2:1636267_at:258:401; Interrogation_Position=225; Antisense; GACATACAGCGCTCTGGAGGGCTGC
>probe:Drosophila_2:1636267_at:681:579; Interrogation_Position=251; Antisense; TGGCCTACAGGCATCGCGTGGAGCA
>probe:Drosophila_2:1636267_at:351:113; Interrogation_Position=272; Antisense; AGCACCTTGGCAGCTCCGTGCGTAA
>probe:Drosophila_2:1636267_at:721:291; Interrogation_Position=288; Antisense; CGTGCGTAAGCTGGTGGCGCTCTAC
>probe:Drosophila_2:1636267_at:3:645; Interrogation_Position=308; Antisense; TCTACGACACCGTGGGCCAGATGAA
>probe:Drosophila_2:1636267_at:171:537; Interrogation_Position=53; Antisense; GGTCGAACAACACATTGCTCCACAT
>probe:Drosophila_2:1636267_at:224:433; Interrogation_Position=79; Antisense; GAGTCCAACAGCAAGGCATTCAGTC
>probe:Drosophila_2:1636267_at:164:267; Interrogation_Position=99; Antisense; CAGTCAGAATGTGGCTTTGTCGGAG

Paste this into a BLAST search page for me
AGAAGATGTACAACCTCAGGCCGGAATGAACCGCCAGCTGGCTAAGATAGGGAGGCTGAGATGACCCTGTCCAAGTGACCCTGTCCAAGATCCTGGAGAAGAACTTCAAGCTGCTCATGTCTAGCTCATGTCTAGCAGTGACCAGCGGGAGACATACAGCGCTCTGGAGGGCTGCTGGCCTACAGGCATCGCGTGGAGCAAGCACCTTGGCAGCTCCGTGCGTAACGTGCGTAAGCTGGTGGCGCTCTACTCTACGACACCGTGGGCCAGATGAAGGTCGAACAACACATTGCTCCACATGAGTCCAACAGCAAGGCATTCAGTCCAGTCAGAATGTGGCTTTGTCGGAG

Full Affymetrix probeset data:

Annotations for 1636267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720