FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636269_at:

>probe:Drosophila_2:1636269_at:302:445; Interrogation_Position=1018; Antisense; GATGAATCCGATGAGCTCTTGTCTA
>probe:Drosophila_2:1636269_at:394:317; Interrogation_Position=1107; Antisense; GCCGGGAAGCAAGCGGTACTACCTT
>probe:Drosophila_2:1636269_at:68:225; Interrogation_Position=1147; Antisense; AAGGAGTTCTCCAACTGTTCGCCGT
>probe:Drosophila_2:1636269_at:101:479; Interrogation_Position=1175; Antisense; GTTTCGATCCCAGTCCTATTATGGA
>probe:Drosophila_2:1636269_at:3:227; Interrogation_Position=1205; Antisense; AAGGCAATGTGTTTTGTCCCGGCAA
>probe:Drosophila_2:1636269_at:557:63; Interrogation_Position=1243; Antisense; ATGTGTCCGTGGAAGCAACGCTCCT
>probe:Drosophila_2:1636269_at:486:223; Interrogation_Position=1297; Antisense; AAGGTTTGCCGATGCGTACAGCGCG
>probe:Drosophila_2:1636269_at:272:567; Interrogation_Position=1321; Antisense; GGCACCATCTTCACTAAGTTCGAGG
>probe:Drosophila_2:1636269_at:581:291; Interrogation_Position=1377; Antisense; CGATTTTTGTCCGTGCCGCGAAAAG
>probe:Drosophila_2:1636269_at:691:91; Interrogation_Position=1412; Antisense; AGTTCTTAGAATTGTACCACGCTGA
>probe:Drosophila_2:1636269_at:53:333; Interrogation_Position=1432; Antisense; GCTGAAATGTGGTCCCGTCCGGAAA
>probe:Drosophila_2:1636269_at:217:531; Interrogation_Position=1464; Antisense; GGGTCGCGAGATCCAACTCAATGAG
>probe:Drosophila_2:1636269_at:287:93; Interrogation_Position=1487; Antisense; AGATCAAGGAACTGCTCGTACCCAC
>probe:Drosophila_2:1636269_at:341:725; Interrogation_Position=973; Antisense; TTGATAATCTATGCTCCAGAGCCGG

Paste this into a BLAST search page for me
GATGAATCCGATGAGCTCTTGTCTAGCCGGGAAGCAAGCGGTACTACCTTAAGGAGTTCTCCAACTGTTCGCCGTGTTTCGATCCCAGTCCTATTATGGAAAGGCAATGTGTTTTGTCCCGGCAAATGTGTCCGTGGAAGCAACGCTCCTAAGGTTTGCCGATGCGTACAGCGCGGGCACCATCTTCACTAAGTTCGAGGCGATTTTTGTCCGTGCCGCGAAAAGAGTTCTTAGAATTGTACCACGCTGAGCTGAAATGTGGTCCCGTCCGGAAAGGGTCGCGAGATCCAACTCAATGAGAGATCAAGGAACTGCTCGTACCCACTTGATAATCTATGCTCCAGAGCCGG

Full Affymetrix probeset data:

Annotations for 1636269_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720