FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636270_at:

>probe:Drosophila_2:1636270_at:632:397; Interrogation_Position=178; Antisense; GACACCAGTATTCCTGTGCCAAGAA
>probe:Drosophila_2:1636270_at:319:197; Interrogation_Position=214; Antisense; AACGAGAACATTGCCTGTTGCGCCA
>probe:Drosophila_2:1636270_at:395:197; Interrogation_Position=259; Antisense; AACGTGCTGGTTAACCAACTGCGAA
>probe:Drosophila_2:1636270_at:527:191; Interrogation_Position=307; Antisense; AACTTCGGTGAGATGATTCCTTGCG
>probe:Drosophila_2:1636270_at:145:9; Interrogation_Position=322; Antisense; ATTCCTTGCGAGCAGTTGGTCACGA
>probe:Drosophila_2:1636270_at:716:587; Interrogation_Position=338; Antisense; TGGTCACGAACCTTTGCGATATCAA
>probe:Drosophila_2:1636270_at:450:25; Interrogation_Position=378; Antisense; ATATGGTGGCAAACGACCCTTCGGG
>probe:Drosophila_2:1636270_at:682:683; Interrogation_Position=404; Antisense; TATCGTTTCTTTACATGGGCTGGGA
>probe:Drosophila_2:1636270_at:272:319; Interrogation_Position=431; Antisense; GCCGCTTCGGGTTTCAGTTGTATCA
>probe:Drosophila_2:1636270_at:317:483; Interrogation_Position=450; Antisense; GTATCAGTCCGATCCCAGTGGAAAC
>probe:Drosophila_2:1636270_at:76:3; Interrogation_Position=555; Antisense; GGGCTACGTAAGTCCTTCGGTCGAG
>probe:Drosophila_2:1636270_at:417:559; Interrogation_Position=651; Antisense; GGAAATTGCTTTCGTACAGCGTTAC
>probe:Drosophila_2:1636270_at:172:187; Interrogation_Position=679; Antisense; AACACCACCGTCTTTCATATTTTAG
>probe:Drosophila_2:1636270_at:281:177; Interrogation_Position=708; Antisense; AAACGAGATCCACCGGCTAATCGAA

Paste this into a BLAST search page for me
GACACCAGTATTCCTGTGCCAAGAAAACGAGAACATTGCCTGTTGCGCCAAACGTGCTGGTTAACCAACTGCGAAAACTTCGGTGAGATGATTCCTTGCGATTCCTTGCGAGCAGTTGGTCACGATGGTCACGAACCTTTGCGATATCAAATATGGTGGCAAACGACCCTTCGGGTATCGTTTCTTTACATGGGCTGGGAGCCGCTTCGGGTTTCAGTTGTATCAGTATCAGTCCGATCCCAGTGGAAACGGGCTACGTAAGTCCTTCGGTCGAGGGAAATTGCTTTCGTACAGCGTTACAACACCACCGTCTTTCATATTTTAGAAACGAGATCCACCGGCTAATCGAA

Full Affymetrix probeset data:

Annotations for 1636270_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720