Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636271_a_at:

>probe:Drosophila_2:1636271_a_at:208:413; Interrogation_Position=112; Antisense; GACCGATGGATTCCAATCTGCGCAA
>probe:Drosophila_2:1636271_a_at:453:105; Interrogation_Position=13; Antisense; AGACTAATCAGCTGTTCCGCTCGTC
>probe:Drosophila_2:1636271_a_at:418:195; Interrogation_Position=175; Antisense; AACTGTGTTTCAGCCGATGCGTGGA
>probe:Drosophila_2:1636271_a_at:490:51; Interrogation_Position=191; Antisense; ATGCGTGGATAATCTCAGCCAGCGC
>probe:Drosophila_2:1636271_a_at:298:413; Interrogation_Position=234; Antisense; GACCTCTGTGTGGACAGGTGCGTTA
>probe:Drosophila_2:1636271_a_at:59:81; Interrogation_Position=249; Antisense; AGGTGCGTTACCAAGTTCGCGCGCT
>probe:Drosophila_2:1636271_a_at:578:717; Interrogation_Position=264; Antisense; TTCGCGCGCTTCAACCAGAATATGA
>probe:Drosophila_2:1636271_a_at:529:597; Interrogation_Position=305; Antisense; TGTGCAGACCACAATCAACGCCAAG
>probe:Drosophila_2:1636271_a_at:250:169; Interrogation_Position=340; Antisense; AAATGGAGGAGAACGCCCGCAAGGC
>probe:Drosophila_2:1636271_a_at:427:121; Interrogation_Position=394; Antisense; AGCGACTGAAAGAGGCGGCCGCCAC
>probe:Drosophila_2:1636271_a_at:610:565; Interrogation_Position=453; Antisense; GGCAATCTGTCCATGTAGCAGCAGT
>probe:Drosophila_2:1636271_a_at:134:115; Interrogation_Position=469; Antisense; AGCAGCAGTGGCATGCAACGCCGCA
>probe:Drosophila_2:1636271_a_at:480:621; Interrogation_Position=496; Antisense; TGCTGTTCTCGATCCTAGATAGCTA
>probe:Drosophila_2:1636271_a_at:25:201; Interrogation_Position=96; Antisense; AACGCAACTTGCTATCGACCGATGG

Paste this into a BLAST search page for me
GACCGATGGATTCCAATCTGCGCAAAGACTAATCAGCTGTTCCGCTCGTCAACTGTGTTTCAGCCGATGCGTGGAATGCGTGGATAATCTCAGCCAGCGCGACCTCTGTGTGGACAGGTGCGTTAAGGTGCGTTACCAAGTTCGCGCGCTTTCGCGCGCTTCAACCAGAATATGATGTGCAGACCACAATCAACGCCAAGAAATGGAGGAGAACGCCCGCAAGGCAGCGACTGAAAGAGGCGGCCGCCACGGCAATCTGTCCATGTAGCAGCAGTAGCAGCAGTGGCATGCAACGCCGCATGCTGTTCTCGATCCTAGATAGCTAAACGCAACTTGCTATCGACCGATGG

Full Affymetrix probeset data:

Annotations for 1636271_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime