Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636272_at:

>probe:Drosophila_2:1636272_at:686:555; Interrogation_Position=2258; Antisense; GGACCCATGGACATATCTCACAACA
>probe:Drosophila_2:1636272_at:320:185; Interrogation_Position=2333; Antisense; AACAATCCGTCGACGAAATACGCAG
>probe:Drosophila_2:1636272_at:712:101; Interrogation_Position=2358; Antisense; AGAGCATGGAGAACAGCCTGTCGCA
>probe:Drosophila_2:1636272_at:154:595; Interrogation_Position=2394; Antisense; TGGGCGTGCCGGGATTAACGCAATT
>probe:Drosophila_2:1636272_at:292:453; Interrogation_Position=2437; Antisense; GATCTCAACACGGATGCGTTTCTGC
>probe:Drosophila_2:1636272_at:309:711; Interrogation_Position=2456; Antisense; TTCTGCGCGGCCGTAACTTTTACTT
>probe:Drosophila_2:1636272_at:704:697; Interrogation_Position=2474; Antisense; TTTACTTCCACCAGAGTTGTGCCAA
>probe:Drosophila_2:1636272_at:163:467; Interrogation_Position=2489; Antisense; GTTGTGCCAACGTCATGAGCAGCTA
>probe:Drosophila_2:1636272_at:528:613; Interrogation_Position=2519; Antisense; TGAACAAGGAGCTTCTCAGCCAGGC
>probe:Drosophila_2:1636272_at:52:651; Interrogation_Position=2534; Antisense; TCAGCCAGGCCCAGAATCAACAGAG
>probe:Drosophila_2:1636272_at:645:109; Interrogation_Position=2546; Antisense; AGAATCAACAGAGGGCGGCCGCCAA
>probe:Drosophila_2:1636272_at:14:353; Interrogation_Position=2658; Antisense; GCAGCAGAGCGTTTCGCAGGCCATG
>probe:Drosophila_2:1636272_at:529:391; Interrogation_Position=2773; Antisense; GAAACGCGACGAGCCGAAGTGGTTA
>probe:Drosophila_2:1636272_at:631:525; Interrogation_Position=2801; Antisense; GGGCATCCCCAAAGTAGGCAACACC

Paste this into a BLAST search page for me
GGACCCATGGACATATCTCACAACAAACAATCCGTCGACGAAATACGCAGAGAGCATGGAGAACAGCCTGTCGCATGGGCGTGCCGGGATTAACGCAATTGATCTCAACACGGATGCGTTTCTGCTTCTGCGCGGCCGTAACTTTTACTTTTTACTTCCACCAGAGTTGTGCCAAGTTGTGCCAACGTCATGAGCAGCTATGAACAAGGAGCTTCTCAGCCAGGCTCAGCCAGGCCCAGAATCAACAGAGAGAATCAACAGAGGGCGGCCGCCAAGCAGCAGAGCGTTTCGCAGGCCATGGAAACGCGACGAGCCGAAGTGGTTAGGGCATCCCCAAAGTAGGCAACACC

Full Affymetrix probeset data:

Annotations for 1636272_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime