FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636274_at:

>probe:Drosophila_2:1636274_at:602:401; Interrogation_Position=1816; Antisense; GACTTGTTTGTAATGCGCGGACAGT
>probe:Drosophila_2:1636274_at:409:341; Interrogation_Position=1852; Antisense; GCTTCCCGTTGTGTGGGAATCCCGA
>probe:Drosophila_2:1636274_at:549:563; Interrogation_Position=1867; Antisense; GGAATCCCGAGCGATGCGGCAAAAT
>probe:Drosophila_2:1636274_at:163:427; Interrogation_Position=1910; Antisense; GAGATGAGGCATGTGGCACCGCCCA
>probe:Drosophila_2:1636274_at:641:11; Interrogation_Position=1995; Antisense; ATTAAGGCGATCGAACACGCGACCC
>probe:Drosophila_2:1636274_at:87:387; Interrogation_Position=2030; Antisense; GAACACACATCGTTGCGGAGTGGAA
>probe:Drosophila_2:1636274_at:139:35; Interrogation_Position=2080; Antisense; ATCAGCTTCTATATGCATGGAACGC
>probe:Drosophila_2:1636274_at:76:563; Interrogation_Position=2098; Antisense; GGAACGCATATAGACGCACGTATTG
>probe:Drosophila_2:1636274_at:498:481; Interrogation_Position=2117; Antisense; GTATTGTTAACATCACCCATATCCC
>probe:Drosophila_2:1636274_at:46:309; Interrogation_Position=2133; Antisense; CCATATCCCATATCCTAGTACTAGT
>probe:Drosophila_2:1636274_at:258:179; Interrogation_Position=2167; Antisense; AAACAGTATCCTATAATCCCACCAA
>probe:Drosophila_2:1636274_at:482:199; Interrogation_Position=2232; Antisense; AACGAGAGCATTTTCCGGCTAGCTG
>probe:Drosophila_2:1636274_at:666:619; Interrogation_Position=2255; Antisense; TGCTACCCCGAGCTTAATCGAATTA
>probe:Drosophila_2:1636274_at:657:59; Interrogation_Position=2361; Antisense; ATGTCTATGTCCTAAGTGCTATCAG

Paste this into a BLAST search page for me
GACTTGTTTGTAATGCGCGGACAGTGCTTCCCGTTGTGTGGGAATCCCGAGGAATCCCGAGCGATGCGGCAAAATGAGATGAGGCATGTGGCACCGCCCAATTAAGGCGATCGAACACGCGACCCGAACACACATCGTTGCGGAGTGGAAATCAGCTTCTATATGCATGGAACGCGGAACGCATATAGACGCACGTATTGGTATTGTTAACATCACCCATATCCCCCATATCCCATATCCTAGTACTAGTAAACAGTATCCTATAATCCCACCAAAACGAGAGCATTTTCCGGCTAGCTGTGCTACCCCGAGCTTAATCGAATTAATGTCTATGTCCTAAGTGCTATCAG

Full Affymetrix probeset data:

Annotations for 1636274_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720