Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636275_a_at:

>probe:Drosophila_2:1636275_a_at:107:21; Interrogation_Position=1006; Antisense; ATATTTATACCCATGGCCACTTCGA
>probe:Drosophila_2:1636275_a_at:448:369; Interrogation_Position=1050; Antisense; GAATGCAGGACTTGGCTTTGCCATT
>probe:Drosophila_2:1636275_a_at:307:587; Interrogation_Position=1082; Antisense; TGGACTCGTCGATGATGCCGGAACT
>probe:Drosophila_2:1636275_a_at:464:685; Interrogation_Position=1111; Antisense; TATCTGGTGGACATCCGACACTCGG
>probe:Drosophila_2:1636275_a_at:652:145; Interrogation_Position=1130; Antisense; ACTCGGCGGTCTACGGCAGCGTTTA
>probe:Drosophila_2:1636275_a_at:255:299; Interrogation_Position=1200; Antisense; CGCCTTATCTGGATCGCTGGTGAAG
>probe:Drosophila_2:1636275_a_at:287:729; Interrogation_Position=1250; Antisense; TTGGAATTGCCATACTCTGCTTTAT
>probe:Drosophila_2:1636275_a_at:621:703; Interrogation_Position=1271; Antisense; TTATGTATGCTCCATTGCTGACGCT
>probe:Drosophila_2:1636275_a_at:26:45; Interrogation_Position=828; Antisense; ATCGCTACCGCTGTGGATGGTGGAC
>probe:Drosophila_2:1636275_a_at:679:189; Interrogation_Position=853; Antisense; AACATGGGCGCCACTCGTTGGGAGC
>probe:Drosophila_2:1636275_a_at:128:605; Interrogation_Position=914; Antisense; TGATTGGCACCAATCTCTTCGGACC
>probe:Drosophila_2:1636275_a_at:6:645; Interrogation_Position=929; Antisense; TCTTCGGACCGCTGGGACACAAAAT
>probe:Drosophila_2:1636275_a_at:687:247; Interrogation_Position=951; Antisense; AATTGGACGATGGTTTGCCGCGTGC
>probe:Drosophila_2:1636275_a_at:33:627; Interrogation_Position=966; Antisense; TGCCGCGTGCTTGGGATTGATTATC

Paste this into a BLAST search page for me
ATATTTATACCCATGGCCACTTCGAGAATGCAGGACTTGGCTTTGCCATTTGGACTCGTCGATGATGCCGGAACTTATCTGGTGGACATCCGACACTCGGACTCGGCGGTCTACGGCAGCGTTTACGCCTTATCTGGATCGCTGGTGAAGTTGGAATTGCCATACTCTGCTTTATTTATGTATGCTCCATTGCTGACGCTATCGCTACCGCTGTGGATGGTGGACAACATGGGCGCCACTCGTTGGGAGCTGATTGGCACCAATCTCTTCGGACCTCTTCGGACCGCTGGGACACAAAATAATTGGACGATGGTTTGCCGCGTGCTGCCGCGTGCTTGGGATTGATTATC

Full Affymetrix probeset data:

Annotations for 1636275_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime