FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636278_at:

>probe:Drosophila_2:1636278_at:571:91; Interrogation_Position=161; Antisense; AGTTACAACAACCAACCGGCGACAG
>probe:Drosophila_2:1636278_at:550:659; Interrogation_Position=203; Antisense; TAAGCCATAAATGCCTGCTGCACAT
>probe:Drosophila_2:1636278_at:716:61; Interrogation_Position=241; Antisense; ATGTCGTTGTTGCTGCGTGTCCACA
>probe:Drosophila_2:1636278_at:71:157; Interrogation_Position=263; Antisense; ACACGCTTGGCGGTCACTTAACAAT
>probe:Drosophila_2:1636278_at:544:707; Interrogation_Position=280; Antisense; TTAACAATCCTAACCGACTTGGCCA
>probe:Drosophila_2:1636278_at:24:293; Interrogation_Position=316; Antisense; CGTTCTGGACAGCTCGGATATATAA
>probe:Drosophila_2:1636278_at:250:59; Interrogation_Position=359; Antisense; ATGTGGGCGAAGTTTTCCAGGACGA
>probe:Drosophila_2:1636278_at:541:409; Interrogation_Position=379; Antisense; GACGAGAAGAACATGGCCGCGATCT
>probe:Drosophila_2:1636278_at:235:607; Interrogation_Position=404; Antisense; TGATGCGGCGCCACATGGAAACCGG
>probe:Drosophila_2:1636278_at:611:131; Interrogation_Position=424; Antisense; ACCGGCGACCTGATAATGGAGGGCA
>probe:Drosophila_2:1636278_at:160:313; Interrogation_Position=55; Antisense; GCCACTTGTTGCTTTGAACTTATTT
>probe:Drosophila_2:1636278_at:315:389; Interrogation_Position=571; Antisense; GAAACTTATTTTTGCACTGTCGGCT
>probe:Drosophila_2:1636278_at:704:91; Interrogation_Position=630; Antisense; AGTTAAATGTGTGGCTGCTACCTGA
>probe:Drosophila_2:1636278_at:537:221; Interrogation_Position=86; Antisense; AAGGTCGTCGTGTCCAACTAGCAAA

Paste this into a BLAST search page for me
AGTTACAACAACCAACCGGCGACAGTAAGCCATAAATGCCTGCTGCACATATGTCGTTGTTGCTGCGTGTCCACAACACGCTTGGCGGTCACTTAACAATTTAACAATCCTAACCGACTTGGCCACGTTCTGGACAGCTCGGATATATAAATGTGGGCGAAGTTTTCCAGGACGAGACGAGAAGAACATGGCCGCGATCTTGATGCGGCGCCACATGGAAACCGGACCGGCGACCTGATAATGGAGGGCAGCCACTTGTTGCTTTGAACTTATTTGAAACTTATTTTTGCACTGTCGGCTAGTTAAATGTGTGGCTGCTACCTGAAAGGTCGTCGTGTCCAACTAGCAAA

Full Affymetrix probeset data:

Annotations for 1636278_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720