Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636279_at:

>probe:Drosophila_2:1636279_at:560:379; Interrogation_Position=3107; Antisense; GAAGCCCTCTTTCAGTCTGGCCAAT
>probe:Drosophila_2:1636279_at:176:287; Interrogation_Position=3123; Antisense; CTGGCCAATGGCAGGGAGTTGCTCC
>probe:Drosophila_2:1636279_at:425:577; Interrogation_Position=3163; Antisense; GGCCTCTCACTTGGACGTACAGAAA
>probe:Drosophila_2:1636279_at:211:157; Interrogation_Position=3188; Antisense; ACACGCAGTTTTCGGCGGGCACAGA
>probe:Drosophila_2:1636279_at:365:327; Interrogation_Position=3202; Antisense; GCGGGCACAGATACTGAAGCTGCTC
>probe:Drosophila_2:1636279_at:256:207; Interrogation_Position=3218; Antisense; AAGCTGCTCAGCGAGCAAGGTCGCC
>probe:Drosophila_2:1636279_at:234:317; Interrogation_Position=3240; Antisense; GCCGGCTCGAAGTCGCTTTCAAGGA
>probe:Drosophila_2:1636279_at:415:223; Interrogation_Position=3260; Antisense; AAGGACAACAACTCGTCTTCCAAGA
>probe:Drosophila_2:1636279_at:4:177; Interrogation_Position=3324; Antisense; AAACGAAGGCTAGCAGTTCCAAGGA
>probe:Drosophila_2:1636279_at:613:469; Interrogation_Position=3339; Antisense; GTTCCAAGGAACTCAATCTGCTGCT
>probe:Drosophila_2:1636279_at:495:619; Interrogation_Position=3360; Antisense; TGCTTAAGATCCTCGCCCAAGGAGG
>probe:Drosophila_2:1636279_at:146:613; Interrogation_Position=3406; Antisense; TGAACAAATTCAGCTCGTCGCCAAG
>probe:Drosophila_2:1636279_at:98:311; Interrogation_Position=3425; Antisense; GCCAAGGATCTTCAACCCAACAAGA
>probe:Drosophila_2:1636279_at:127:125; Interrogation_Position=3475; Antisense; AGCCGCCAAACCTATGGTCGTGGAA

Paste this into a BLAST search page for me
GAAGCCCTCTTTCAGTCTGGCCAATCTGGCCAATGGCAGGGAGTTGCTCCGGCCTCTCACTTGGACGTACAGAAAACACGCAGTTTTCGGCGGGCACAGAGCGGGCACAGATACTGAAGCTGCTCAAGCTGCTCAGCGAGCAAGGTCGCCGCCGGCTCGAAGTCGCTTTCAAGGAAAGGACAACAACTCGTCTTCCAAGAAAACGAAGGCTAGCAGTTCCAAGGAGTTCCAAGGAACTCAATCTGCTGCTTGCTTAAGATCCTCGCCCAAGGAGGTGAACAAATTCAGCTCGTCGCCAAGGCCAAGGATCTTCAACCCAACAAGAAGCCGCCAAACCTATGGTCGTGGAA

Full Affymetrix probeset data:

Annotations for 1636279_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime