FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636281_at:

>probe:Drosophila_2:1636281_at:634:197; Interrogation_Position=3681; Antisense; AACGCTAAACTTGTAAGCTTTGGAT
>probe:Drosophila_2:1636281_at:122:33; Interrogation_Position=3710; Antisense; ATAATGAGCTTGGTTGGCAATCAAC
>probe:Drosophila_2:1636281_at:489:565; Interrogation_Position=3725; Antisense; GGCAATCAACGTAAATCAGCATTTT
>probe:Drosophila_2:1636281_at:640:609; Interrogation_Position=3764; Antisense; TAATTTCTAAGCTGTTGTCCGTCCC
>probe:Drosophila_2:1636281_at:27:597; Interrogation_Position=3776; Antisense; TGTTGTCCGTCCCACTAAAGAAGTT
>probe:Drosophila_2:1636281_at:471:55; Interrogation_Position=3887; Antisense; ATGTACGCCTAATGTCTAAATCTTA
>probe:Drosophila_2:1636281_at:634:387; Interrogation_Position=3934; Antisense; GAAAATCCCGATAAAAGCTATATAT
>probe:Drosophila_2:1636281_at:663:393; Interrogation_Position=4043; Antisense; GAAATGATATGCCTTTTGGTTGAAA
>probe:Drosophila_2:1636281_at:383:409; Interrogation_Position=4083; Antisense; GACGAACGAGTCTGATTGCATGCAT
>probe:Drosophila_2:1636281_at:171:721; Interrogation_Position=4115; Antisense; TTGCGTAGGAATGGGTCTTCCACTC
>probe:Drosophila_2:1636281_at:533:531; Interrogation_Position=4127; Antisense; GGGTCTTCCACTCGGAGGATCAAGA
>probe:Drosophila_2:1636281_at:677:421; Interrogation_Position=4156; Antisense; GAGAAAACCCTTCATGGTGTTTAGT
>probe:Drosophila_2:1636281_at:305:143; Interrogation_Position=4188; Antisense; ACTGTGTATGTCCTTGTAATGTGTA
>probe:Drosophila_2:1636281_at:43:691; Interrogation_Position=4213; Antisense; TATTGTTGTATACATCCGATAAGCA

Paste this into a BLAST search page for me
AACGCTAAACTTGTAAGCTTTGGATATAATGAGCTTGGTTGGCAATCAACGGCAATCAACGTAAATCAGCATTTTTAATTTCTAAGCTGTTGTCCGTCCCTGTTGTCCGTCCCACTAAAGAAGTTATGTACGCCTAATGTCTAAATCTTAGAAAATCCCGATAAAAGCTATATATGAAATGATATGCCTTTTGGTTGAAAGACGAACGAGTCTGATTGCATGCATTTGCGTAGGAATGGGTCTTCCACTCGGGTCTTCCACTCGGAGGATCAAGAGAGAAAACCCTTCATGGTGTTTAGTACTGTGTATGTCCTTGTAATGTGTATATTGTTGTATACATCCGATAAGCA

Full Affymetrix probeset data:

Annotations for 1636281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720