FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636283_at:

>probe:Drosophila_2:1636283_at:615:399; Interrogation_Position=110; Antisense; GACAGAAGCGCTGGCTGATCTACCA
>probe:Drosophila_2:1636283_at:321:91; Interrogation_Position=152; Antisense; AGTTTAGTATTGGTCCCTCGATGCC
>probe:Drosophila_2:1636283_at:38:667; Interrogation_Position=223; Antisense; TACACGCTCCAAGGTGGTTCCTATT
>probe:Drosophila_2:1636283_at:536:717; Interrogation_Position=295; Antisense; TTCGCTCGTTCCTTGATGCAAATGC
>probe:Drosophila_2:1636283_at:208:275; Interrogation_Position=381; Antisense; CTTGGTCTACACTGCACTGGAGGAG
>probe:Drosophila_2:1636283_at:706:231; Interrogation_Position=424; Antisense; AATGACCGCTCCATGGGCAGACAAT
>probe:Drosophila_2:1636283_at:675:105; Interrogation_Position=442; Antisense; AGACAATGTCTGCTGCGCTCCATAT
>probe:Drosophila_2:1636283_at:459:325; Interrogation_Position=467; Antisense; GCGAGAATGCTCAGATCCATCATCA
>probe:Drosophila_2:1636283_at:447:269; Interrogation_Position=487; Antisense; CATCATATCGGTGTGTTCTCGGAAA
>probe:Drosophila_2:1636283_at:281:587; Interrogation_Position=515; Antisense; TGGATATTGTACTCAGTCCCGGCAA
>probe:Drosophila_2:1636283_at:441:231; Interrogation_Position=553; Antisense; AATGACTACCATGATGCCTACGCCG
>probe:Drosophila_2:1636283_at:488:247; Interrogation_Position=595; Antisense; AATTGCTTGGGCCTGTACAGTGCCT
>probe:Drosophila_2:1636283_at:415:305; Interrogation_Position=639; Antisense; CCTCGACGGGCTTTTGATTGTGGAA
>probe:Drosophila_2:1636283_at:143:463; Interrogation_Position=73; Antisense; GATTCATCCCGAAATCTCACGGAAT

Paste this into a BLAST search page for me
GACAGAAGCGCTGGCTGATCTACCAAGTTTAGTATTGGTCCCTCGATGCCTACACGCTCCAAGGTGGTTCCTATTTTCGCTCGTTCCTTGATGCAAATGCCTTGGTCTACACTGCACTGGAGGAGAATGACCGCTCCATGGGCAGACAATAGACAATGTCTGCTGCGCTCCATATGCGAGAATGCTCAGATCCATCATCACATCATATCGGTGTGTTCTCGGAAATGGATATTGTACTCAGTCCCGGCAAAATGACTACCATGATGCCTACGCCGAATTGCTTGGGCCTGTACAGTGCCTCCTCGACGGGCTTTTGATTGTGGAAGATTCATCCCGAAATCTCACGGAAT

Full Affymetrix probeset data:

Annotations for 1636283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720