FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636287_at:

>probe:Drosophila_2:1636287_at:319:371; Interrogation_Position=1175; Antisense; GAAGGCTCTGGAGGACACCGAAGAA
>probe:Drosophila_2:1636287_at:51:413; Interrogation_Position=1232; Antisense; GACCGACGAGGAGGACACGCTGATT
>probe:Drosophila_2:1636287_at:208:357; Interrogation_Position=1277; Antisense; GCACACCATGTCTATCAACGGCTAT
>probe:Drosophila_2:1636287_at:390:341; Interrogation_Position=1297; Antisense; GCTATCCGTACCGTCGACAGAACAT
>probe:Drosophila_2:1636287_at:22:725; Interrogation_Position=1330; Antisense; TTGCTCCCAATCTGGCTGATGATGA
>probe:Drosophila_2:1636287_at:506:277; Interrogation_Position=1345; Antisense; CTGATGATGAGCTTCCCTTTACCAT
>probe:Drosophila_2:1636287_at:364:697; Interrogation_Position=1362; Antisense; TTTACCATCTTGTCGTATGCCAATG
>probe:Drosophila_2:1636287_at:496:441; Interrogation_Position=1419; Antisense; GATGGACGCATTGATCTTTCCCATG
>probe:Drosophila_2:1636287_at:524:289; Interrogation_Position=1444; Antisense; CGGACACCACAAGCGCAGAGTTTGA
>probe:Drosophila_2:1636287_at:692:93; Interrogation_Position=1460; Antisense; AGAGTTTGAGTTCCAGGCCACGGTT
>probe:Drosophila_2:1636287_at:378:313; Interrogation_Position=1476; Antisense; GCCACGGTTCCCTTGAGCAGCGAAA
>probe:Drosophila_2:1636287_at:36:113; Interrogation_Position=1546; Antisense; AGCACCTGTTCACCGGCAATTATGA
>probe:Drosophila_2:1636287_at:617:15; Interrogation_Position=1564; Antisense; ATTATGAGCAGAGTGCCATCCCAGC
>probe:Drosophila_2:1636287_at:196:405; Interrogation_Position=1656; Antisense; GACTACAGTCGCATACTCATAAGGA

Paste this into a BLAST search page for me
GAAGGCTCTGGAGGACACCGAAGAAGACCGACGAGGAGGACACGCTGATTGCACACCATGTCTATCAACGGCTATGCTATCCGTACCGTCGACAGAACATTTGCTCCCAATCTGGCTGATGATGACTGATGATGAGCTTCCCTTTACCATTTTACCATCTTGTCGTATGCCAATGGATGGACGCATTGATCTTTCCCATGCGGACACCACAAGCGCAGAGTTTGAAGAGTTTGAGTTCCAGGCCACGGTTGCCACGGTTCCCTTGAGCAGCGAAAAGCACCTGTTCACCGGCAATTATGAATTATGAGCAGAGTGCCATCCCAGCGACTACAGTCGCATACTCATAAGGA

Full Affymetrix probeset data:

Annotations for 1636287_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720