FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636288_at:

>probe:Drosophila_2:1636288_at:525:57; Interrogation_Position=2849; Antisense; ATGAGGCGATGCGTCTTTGCGCCAA
>probe:Drosophila_2:1636288_at:5:545; Interrogation_Position=2915; Antisense; GGACGTTGGCCGAGGACTATCGCAA
>probe:Drosophila_2:1636288_at:297:7; Interrogation_Position=2943; Antisense; ATTCCGAGACTACAAGCTCTTGGAG
>probe:Drosophila_2:1636288_at:533:93; Interrogation_Position=3010; Antisense; AGTTCGGCGATAAGTTGTCCACCTC
>probe:Drosophila_2:1636288_at:189:25; Interrogation_Position=3074; Antisense; ATATGGCCAGGCGATTGCAGAACTT
>probe:Drosophila_2:1636288_at:701:129; Interrogation_Position=3106; Antisense; ACCTCGCAGCGGATTTTTAACCAGA
>probe:Drosophila_2:1636288_at:392:89; Interrogation_Position=3149; Antisense; AGTACTGCAACTCCTTGATCTCAGG
>probe:Drosophila_2:1636288_at:335:605; Interrogation_Position=3164; Antisense; TGATCTCAGGAAGTCCGGCTGGAAT
>probe:Drosophila_2:1636288_at:339:521; Interrogation_Position=3199; Antisense; GTGGCCCAATCCATATTGCGGCGTA
>probe:Drosophila_2:1636288_at:159:621; Interrogation_Position=3215; Antisense; TGCGGCGTACTCGATCGTCACAGGA
>probe:Drosophila_2:1636288_at:102:153; Interrogation_Position=3234; Antisense; ACAGGATCAGTCGTAGGAGTCGCCA
>probe:Drosophila_2:1636288_at:520:431; Interrogation_Position=3250; Antisense; GAGTCGCCAGGATTTGCATGCAACT
>probe:Drosophila_2:1636288_at:586:359; Interrogation_Position=3269; Antisense; GCAACTCCTCCTTCCATTTAAAAAT
>probe:Drosophila_2:1636288_at:195:179; Interrogation_Position=3289; Antisense; AAAATCGTTCTCACCCAAAATCTCT

Paste this into a BLAST search page for me
ATGAGGCGATGCGTCTTTGCGCCAAGGACGTTGGCCGAGGACTATCGCAAATTCCGAGACTACAAGCTCTTGGAGAGTTCGGCGATAAGTTGTCCACCTCATATGGCCAGGCGATTGCAGAACTTACCTCGCAGCGGATTTTTAACCAGAAGTACTGCAACTCCTTGATCTCAGGTGATCTCAGGAAGTCCGGCTGGAATGTGGCCCAATCCATATTGCGGCGTATGCGGCGTACTCGATCGTCACAGGAACAGGATCAGTCGTAGGAGTCGCCAGAGTCGCCAGGATTTGCATGCAACTGCAACTCCTCCTTCCATTTAAAAATAAAATCGTTCTCACCCAAAATCTCT

Full Affymetrix probeset data:

Annotations for 1636288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720