Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636291_at:

>probe:Drosophila_2:1636291_at:569:93; Interrogation_Position=1003; Antisense; AGATATTTGCGTACGCCGTCGGCTA
>probe:Drosophila_2:1636291_at:147:671; Interrogation_Position=1026; Antisense; TACGACTGGTCGAAGGGCCACGAGT
>probe:Drosophila_2:1636291_at:80:211; Interrogation_Position=1065; Antisense; AAGAAGCCCCAAATCTTTCTGCGCT
>probe:Drosophila_2:1636291_at:32:449; Interrogation_Position=1123; Antisense; GATCGGAGGACTACTTTAGCTTTAG
>probe:Drosophila_2:1636291_at:405:677; Interrogation_Position=1145; Antisense; TAGTGAAAACCCCTACGCGTACATG
>probe:Drosophila_2:1636291_at:262:617; Interrogation_Position=619; Antisense; TGCAGAATAGCCCAACCGAGTACAA
>probe:Drosophila_2:1636291_at:29:313; Interrogation_Position=678; Antisense; GCCATTTCCATTTTCCGGGACAAGA
>probe:Drosophila_2:1636291_at:582:567; Interrogation_Position=816; Antisense; GGCACCTCAGGCTACCAGGATATTT
>probe:Drosophila_2:1636291_at:522:89; Interrogation_Position=845; Antisense; AGTAAATGACATCGCATTCCACCCT
>probe:Drosophila_2:1636291_at:287:611; Interrogation_Position=886; Antisense; TGACCGTTGGCTCAGATGGCACCTT
>probe:Drosophila_2:1636291_at:559:67; Interrogation_Position=901; Antisense; ATGGCACCTTCAGTTTCTGGGACAA
>probe:Drosophila_2:1636291_at:537:223; Interrogation_Position=924; Antisense; AAGGATGCCCGGACCAAGCTCAAGT
>probe:Drosophila_2:1636291_at:613:207; Interrogation_Position=939; Antisense; AAGCTCAAGTCCAGCGAGACCATGG
>probe:Drosophila_2:1636291_at:297:49; Interrogation_Position=980; Antisense; ATGCGGATTTAACGCCAACGGCCAG

Paste this into a BLAST search page for me
AGATATTTGCGTACGCCGTCGGCTATACGACTGGTCGAAGGGCCACGAGTAAGAAGCCCCAAATCTTTCTGCGCTGATCGGAGGACTACTTTAGCTTTAGTAGTGAAAACCCCTACGCGTACATGTGCAGAATAGCCCAACCGAGTACAAGCCATTTCCATTTTCCGGGACAAGAGGCACCTCAGGCTACCAGGATATTTAGTAAATGACATCGCATTCCACCCTTGACCGTTGGCTCAGATGGCACCTTATGGCACCTTCAGTTTCTGGGACAAAAGGATGCCCGGACCAAGCTCAAGTAAGCTCAAGTCCAGCGAGACCATGGATGCGGATTTAACGCCAACGGCCAG

Full Affymetrix probeset data:

Annotations for 1636291_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime