FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636292_at:

>probe:Drosophila_2:1636292_at:613:99; Interrogation_Position=1007; Antisense; AGATGGTGTACCTTGACCTGATCCT
>probe:Drosophila_2:1636292_at:263:413; Interrogation_Position=1021; Antisense; GACCTGATCCTCAACGAATCCATGA
>probe:Drosophila_2:1636292_at:329:635; Interrogation_Position=1067; Antisense; TCGTATCCCGACAAACGTCTCAGGA
>probe:Drosophila_2:1636292_at:31:499; Interrogation_Position=1083; Antisense; GTCTCAGGATCTGAAGCTGTCCAAT
>probe:Drosophila_2:1636292_at:470:505; Interrogation_Position=1101; Antisense; GTCCAATGGTATAGTGGTTCCCAAA
>probe:Drosophila_2:1636292_at:720:449; Interrogation_Position=1134; Antisense; GATCGCCATCGACATTTATCACATG
>probe:Drosophila_2:1636292_at:570:551; Interrogation_Position=1191; Antisense; GGAGACCTTCAACCCAGATCATTTC
>probe:Drosophila_2:1636292_at:409:559; Interrogation_Position=1233; Antisense; GGACAAGCATCCGTACGCCTATATA
>probe:Drosophila_2:1636292_at:116:487; Interrogation_Position=1245; Antisense; GTACGCCTATATACCTTTTACCAAG
>probe:Drosophila_2:1636292_at:720:641; Interrogation_Position=1414; Antisense; TCTGTGCCACTGTTGGAGCTCCAAA
>probe:Drosophila_2:1636292_at:510:587; Interrogation_Position=858; Antisense; TGGAGCTTTTGAGACCACGGCTAAT
>probe:Drosophila_2:1636292_at:20:669; Interrogation_Position=889; Antisense; TACTACACCCTGATGTTGCTGGCGA
>probe:Drosophila_2:1636292_at:372:717; Interrogation_Position=904; Antisense; TTGCTGGCGATGTTTCCGGAATACC
>probe:Drosophila_2:1636292_at:8:425; Interrogation_Position=974; Antisense; GAGACTTTGATGTATCCTACGCGGA

Paste this into a BLAST search page for me
AGATGGTGTACCTTGACCTGATCCTGACCTGATCCTCAACGAATCCATGATCGTATCCCGACAAACGTCTCAGGAGTCTCAGGATCTGAAGCTGTCCAATGTCCAATGGTATAGTGGTTCCCAAAGATCGCCATCGACATTTATCACATGGGAGACCTTCAACCCAGATCATTTCGGACAAGCATCCGTACGCCTATATAGTACGCCTATATACCTTTTACCAAGTCTGTGCCACTGTTGGAGCTCCAAATGGAGCTTTTGAGACCACGGCTAATTACTACACCCTGATGTTGCTGGCGATTGCTGGCGATGTTTCCGGAATACCGAGACTTTGATGTATCCTACGCGGA

Full Affymetrix probeset data:

Annotations for 1636292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720