Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636293_at:

>probe:Drosophila_2:1636293_at:457:529; Interrogation_Position=3461; Antisense; GGGTTCACCTTTCGATTCAACGACA
>probe:Drosophila_2:1636293_at:290:639; Interrogation_Position=3477; Antisense; TCAACGACAAGCTCTTCTTCGGTAA
>probe:Drosophila_2:1636293_at:698:687; Interrogation_Position=3553; Antisense; TATTTAATCAAGAGGCATCCCCGCC
>probe:Drosophila_2:1636293_at:278:301; Interrogation_Position=3573; Antisense; CCGCCACAGCTTCAGTGTTAATTCA
>probe:Drosophila_2:1636293_at:604:513; Interrogation_Position=3587; Antisense; GTGTTAATTCAACGCTCAGCTCAGA
>probe:Drosophila_2:1636293_at:664:235; Interrogation_Position=3617; Antisense; AATCGCCGGATTATATTACTATCAC
>probe:Drosophila_2:1636293_at:424:709; Interrogation_Position=3653; Antisense; TTAAATTCTGCTGGCTTCTAGTCGC
>probe:Drosophila_2:1636293_at:219:679; Interrogation_Position=3671; Antisense; TAGTCGCCGTTCTACTCTTCATTTC
>probe:Drosophila_2:1636293_at:293:273; Interrogation_Position=3690; Antisense; CATTTCCTCGCAAAATGTCTGCGCA
>probe:Drosophila_2:1636293_at:312:599; Interrogation_Position=3705; Antisense; TGTCTGCGCAGCTCCAAAACGAAGA
>probe:Drosophila_2:1636293_at:367:345; Interrogation_Position=3818; Antisense; GCATCTTAGCGTATTTGTTGTTGAA
>probe:Drosophila_2:1636293_at:669:695; Interrogation_Position=3853; Antisense; TTATCGTAGTTATATGTTTCGCCAT
>probe:Drosophila_2:1636293_at:7:481; Interrogation_Position=3868; Antisense; GTTTCGCCATTGTATGGTTGCATTA
>probe:Drosophila_2:1636293_at:715:17; Interrogation_Position=4017; Antisense; ATTTACAATATGTCTCGCTTCCAAA

Paste this into a BLAST search page for me
GGGTTCACCTTTCGATTCAACGACATCAACGACAAGCTCTTCTTCGGTAATATTTAATCAAGAGGCATCCCCGCCCCGCCACAGCTTCAGTGTTAATTCAGTGTTAATTCAACGCTCAGCTCAGAAATCGCCGGATTATATTACTATCACTTAAATTCTGCTGGCTTCTAGTCGCTAGTCGCCGTTCTACTCTTCATTTCCATTTCCTCGCAAAATGTCTGCGCATGTCTGCGCAGCTCCAAAACGAAGAGCATCTTAGCGTATTTGTTGTTGAATTATCGTAGTTATATGTTTCGCCATGTTTCGCCATTGTATGGTTGCATTAATTTACAATATGTCTCGCTTCCAAA

Full Affymetrix probeset data:

Annotations for 1636293_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime