Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636295_at:

>probe:Drosophila_2:1636295_at:48:89; Interrogation_Position=1000; Antisense; AGTCTTAAGACTCCTATTAGCCTGA
>probe:Drosophila_2:1636295_at:397:135; Interrogation_Position=1078; Antisense; CCCGTATTCGTTGTGGATTGGCCAG
>probe:Drosophila_2:1636295_at:178:579; Interrogation_Position=1097; Antisense; GGCCAGCTCAGCAGAAACCTTTTTA
>probe:Drosophila_2:1636295_at:431:393; Interrogation_Position=1125; Antisense; GAAAGTCTCGCGTTCAAATCCCAAT
>probe:Drosophila_2:1636295_at:156:167; Interrogation_Position=1140; Antisense; AAATCCCAATCGAGTTCATGCCCTA
>probe:Drosophila_2:1636295_at:434:103; Interrogation_Position=1164; Antisense; AGACCTACTGATGCCAGCTGTTGGA
>probe:Drosophila_2:1636295_at:411:125; Interrogation_Position=1204; Antisense; AGCCTGCGTGAAAGCGATCCTGCTA
>probe:Drosophila_2:1636295_at:576:277; Interrogation_Position=1226; Antisense; CTATATTAAAATCCCATCCGCATCT
>probe:Drosophila_2:1636295_at:715:631; Interrogation_Position=1242; Antisense; TCCGCATCTGCCGAAGGATCTGGAA
>probe:Drosophila_2:1636295_at:566:593; Interrogation_Position=1319; Antisense; TGGGCTTTGAGCGTTACTTGCAGCT
>probe:Drosophila_2:1636295_at:600:149; Interrogation_Position=1334; Antisense; ACTTGCAGCTTGTCACGGGCGTTAA
>probe:Drosophila_2:1636295_at:252:151; Interrogation_Position=1361; Antisense; ACATTCGTGATGTGATACCCTTCCC
>probe:Drosophila_2:1636295_at:15:365; Interrogation_Position=903; Antisense; GAATTCAAACTCTAACTCCGATCTC
>probe:Drosophila_2:1636295_at:455:417; Interrogation_Position=957; Antisense; GAGCTACGATGAAGCCCTGCAAGTA

Paste this into a BLAST search page for me
AGTCTTAAGACTCCTATTAGCCTGACCCGTATTCGTTGTGGATTGGCCAGGGCCAGCTCAGCAGAAACCTTTTTAGAAAGTCTCGCGTTCAAATCCCAATAAATCCCAATCGAGTTCATGCCCTAAGACCTACTGATGCCAGCTGTTGGAAGCCTGCGTGAAAGCGATCCTGCTACTATATTAAAATCCCATCCGCATCTTCCGCATCTGCCGAAGGATCTGGAATGGGCTTTGAGCGTTACTTGCAGCTACTTGCAGCTTGTCACGGGCGTTAAACATTCGTGATGTGATACCCTTCCCGAATTCAAACTCTAACTCCGATCTCGAGCTACGATGAAGCCCTGCAAGTA

Full Affymetrix probeset data:

Annotations for 1636295_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime