FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636296_at:

>probe:Drosophila_2:1636296_at:532:603; Interrogation_Position=369; Antisense; TGTTCCAGCGCAAGCGTTTTCAGTA
>probe:Drosophila_2:1636296_at:666:681; Interrogation_Position=400; Antisense; TATGTCGGCGGTCCATAAGCGATCG
>probe:Drosophila_2:1636296_at:121:605; Interrogation_Position=438; Antisense; TGATCCCATCGCAACTGGATGAACT
>probe:Drosophila_2:1636296_at:413:527; Interrogation_Position=483; Antisense; GGGATTTGGACGTTTTGCTGACTAA
>probe:Drosophila_2:1636296_at:137:507; Interrogation_Position=519; Antisense; GTGCCGAGGAGGCTCCTTTGTTTAA
>probe:Drosophila_2:1636296_at:594:585; Interrogation_Position=544; Antisense; TGGAAGATCCGGATGCTCATACGTC
>probe:Drosophila_2:1636296_at:385:399; Interrogation_Position=570; Antisense; GACACGGCTTTTTCTCCTTATTGGT
>probe:Drosophila_2:1636296_at:531:613; Interrogation_Position=616; Antisense; TGAACTGACGCAAACGACCGAGCCA
>probe:Drosophila_2:1636296_at:498:251; Interrogation_Position=647; Antisense; CAAGGGACACCAACGATTCACCAGT
>probe:Drosophila_2:1636296_at:337:649; Interrogation_Position=664; Antisense; TCACCAGTCCATTAATGCACGGGCG
>probe:Drosophila_2:1636296_at:478:371; Interrogation_Position=692; Antisense; GAAGGCGACTCCATATCGGGCGACA
>probe:Drosophila_2:1636296_at:640:501; Interrogation_Position=766; Antisense; GTCGCTACAGCGAATTCCAGACGTT
>probe:Drosophila_2:1636296_at:489:137; Interrogation_Position=786; Antisense; ACGTTTCGGGCGTCCAAGAGCTAGA
>probe:Drosophila_2:1636296_at:275:371; Interrogation_Position=911; Antisense; GAAGGATTCACGCTGGTCGACGATC

Paste this into a BLAST search page for me
TGTTCCAGCGCAAGCGTTTTCAGTATATGTCGGCGGTCCATAAGCGATCGTGATCCCATCGCAACTGGATGAACTGGGATTTGGACGTTTTGCTGACTAAGTGCCGAGGAGGCTCCTTTGTTTAATGGAAGATCCGGATGCTCATACGTCGACACGGCTTTTTCTCCTTATTGGTTGAACTGACGCAAACGACCGAGCCACAAGGGACACCAACGATTCACCAGTTCACCAGTCCATTAATGCACGGGCGGAAGGCGACTCCATATCGGGCGACAGTCGCTACAGCGAATTCCAGACGTTACGTTTCGGGCGTCCAAGAGCTAGAGAAGGATTCACGCTGGTCGACGATC

Full Affymetrix probeset data:

Annotations for 1636296_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720