Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636297_at:

>probe:Drosophila_2:1636297_at:598:539; Interrogation_Position=5754; Antisense; GGTTCTAACCTTGGGCTCGTACAGC
>probe:Drosophila_2:1636297_at:25:125; Interrogation_Position=5776; Antisense; AGCCGGTCGAACTACACGGACATAT
>probe:Drosophila_2:1636297_at:29:551; Interrogation_Position=5880; Antisense; GGAGTGCCTCACTTCCAAGAGATTT
>probe:Drosophila_2:1636297_at:43:603; Interrogation_Position=5921; Antisense; TGTTCGAACGACTGCTCAACCTTAT
>probe:Drosophila_2:1636297_at:668:651; Interrogation_Position=5936; Antisense; TCAACCTTATATTCTCGCCGAGTGC
>probe:Drosophila_2:1636297_at:269:269; Interrogation_Position=5973; Antisense; CATCGCCTTCATCATACTGATCAGG
>probe:Drosophila_2:1636297_at:461:647; Interrogation_Position=5993; Antisense; TCAGGCATCTGAAGCACAATCCCGG
>probe:Drosophila_2:1636297_at:126:565; Interrogation_Position=6016; Antisense; GGCAATTCGGACATCAACCTGTGCA
>probe:Drosophila_2:1636297_at:644:667; Interrogation_Position=6052; Antisense; TACATTCAGTGCCTGCGGGACGAGA
>probe:Drosophila_2:1636297_at:144:239; Interrogation_Position=6106; Antisense; AATCTGCCGGAGATGTCGGTGCTGC
>probe:Drosophila_2:1636297_at:367:535; Interrogation_Position=6123; Antisense; GGTGCTGCTGCAGGAACACGCAATC
>probe:Drosophila_2:1636297_at:248:237; Interrogation_Position=6144; Antisense; AATCGACATCCTAACGGTGGCCTTC
>probe:Drosophila_2:1636297_at:189:615; Interrogation_Position=6179; Antisense; TGAAGTCGTGCCTGAACACTGGCCA
>probe:Drosophila_2:1636297_at:570:223; Interrogation_Position=6214; Antisense; AAGGTTCTCCAGACTCTAGTGATCC

Paste this into a BLAST search page for me
GGTTCTAACCTTGGGCTCGTACAGCAGCCGGTCGAACTACACGGACATATGGAGTGCCTCACTTCCAAGAGATTTTGTTCGAACGACTGCTCAACCTTATTCAACCTTATATTCTCGCCGAGTGCCATCGCCTTCATCATACTGATCAGGTCAGGCATCTGAAGCACAATCCCGGGGCAATTCGGACATCAACCTGTGCATACATTCAGTGCCTGCGGGACGAGAAATCTGCCGGAGATGTCGGTGCTGCGGTGCTGCTGCAGGAACACGCAATCAATCGACATCCTAACGGTGGCCTTCTGAAGTCGTGCCTGAACACTGGCCAAAGGTTCTCCAGACTCTAGTGATCC

Full Affymetrix probeset data:

Annotations for 1636297_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime