FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636298_at:

>probe:Drosophila_2:1636298_at:408:237; Interrogation_Position=155; Antisense; AATCGACCGTTATCTCTGGCTAGAA
>probe:Drosophila_2:1636298_at:190:177; Interrogation_Position=197; Antisense; AAACGAGCAACGTCTGCAGTCGACA
>probe:Drosophila_2:1636298_at:529:349; Interrogation_Position=212; Antisense; GCAGTCGACATTCCAGTAGCTACAA
>probe:Drosophila_2:1636298_at:516:531; Interrogation_Position=286; Antisense; GGTGTTTCTGGCCAACTACGTCTAT
>probe:Drosophila_2:1636298_at:568:191; Interrogation_Position=299; Antisense; AACTACGTCTATGAGTGCGCCATTC
>probe:Drosophila_2:1636298_at:260:11; Interrogation_Position=320; Antisense; ATTCGTCGCACTGCAAACAGTTGCA
>probe:Drosophila_2:1636298_at:521:101; Interrogation_Position=347; Antisense; AGACCACCAGGGTCGGAGCCGGAAT
>probe:Drosophila_2:1636298_at:52:23; Interrogation_Position=38; Antisense; ATATTTCTTATGTGCTCCCTGCTTG
>probe:Drosophila_2:1636298_at:675:383; Interrogation_Position=414; Antisense; GAACTGTGACACTGGCAGCCGGCGA
>probe:Drosophila_2:1636298_at:143:477; Interrogation_Position=472; Antisense; GTTTTGCATGCGATTAGACCAGCTG
>probe:Drosophila_2:1636298_at:647:439; Interrogation_Position=508; Antisense; GATGTTAGCCCGGTTTTTTACATAT
>probe:Drosophila_2:1636298_at:549:259; Interrogation_Position=538; Antisense; CACTGGCATATATTTCGTACGGCAA
>probe:Drosophila_2:1636298_at:281:275; Interrogation_Position=59; Antisense; CTTGGCATCTCTTTCGCTATAGTGA
>probe:Drosophila_2:1636298_at:148:687; Interrogation_Position=76; Antisense; TATAGTGATCGAGGCCAACTGTCTG

Paste this into a BLAST search page for me
AATCGACCGTTATCTCTGGCTAGAAAAACGAGCAACGTCTGCAGTCGACAGCAGTCGACATTCCAGTAGCTACAAGGTGTTTCTGGCCAACTACGTCTATAACTACGTCTATGAGTGCGCCATTCATTCGTCGCACTGCAAACAGTTGCAAGACCACCAGGGTCGGAGCCGGAATATATTTCTTATGTGCTCCCTGCTTGGAACTGTGACACTGGCAGCCGGCGAGTTTTGCATGCGATTAGACCAGCTGGATGTTAGCCCGGTTTTTTACATATCACTGGCATATATTTCGTACGGCAACTTGGCATCTCTTTCGCTATAGTGATATAGTGATCGAGGCCAACTGTCTG

Full Affymetrix probeset data:

Annotations for 1636298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720