FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636299_at:

>probe:Drosophila_2:1636299_at:462:175; Interrogation_Position=1672; Antisense; AAACCCGATCCCGTGCAGTGCGAGA
>probe:Drosophila_2:1636299_at:104:151; Interrogation_Position=1718; Antisense; ACTTGTCCGGACTAAAGCAGCACAT
>probe:Drosophila_2:1636299_at:142:611; Interrogation_Position=1742; Antisense; TGAAAACGGTACACGAGCCGCCGGG
>probe:Drosophila_2:1636299_at:538:113; Interrogation_Position=1772; Antisense; AGCACCGCTGTCATATCTGCAACAA
>probe:Drosophila_2:1636299_at:159:641; Interrogation_Position=1787; Antisense; TCTGCAACAAGACATCCACCAATTC
>probe:Drosophila_2:1636299_at:504:159; Interrogation_Position=1838; Antisense; ACAACCACCTCTGTGAGCGAAAGTT
>probe:Drosophila_2:1636299_at:20:169; Interrogation_Position=1881; Antisense; AAAGGCATTTAAGCGTCCACAGGAT
>probe:Drosophila_2:1636299_at:703:607; Interrogation_Position=1907; Antisense; TGAGGGAGCACACATCAACGCACAC
>probe:Drosophila_2:1636299_at:25:427; Interrogation_Position=1934; Antisense; GAGAGGTGCTGTACACCTGTCCTAA
>probe:Drosophila_2:1636299_at:43:473; Interrogation_Position=1971; Antisense; GTTCTTTTCCAACGCCAACATGTAC
>probe:Drosophila_2:1636299_at:38:191; Interrogation_Position=1987; Antisense; AACATGTACAAGCACCGTCAGCGGC
>probe:Drosophila_2:1636299_at:215:37; Interrogation_Position=2062; Antisense; ATCATGAAGATTTCGCAGGGCGCCA
>probe:Drosophila_2:1636299_at:221:83; Interrogation_Position=2078; Antisense; AGGGCGCCACCACAGCGATGAAGAA
>probe:Drosophila_2:1636299_at:230:111; Interrogation_Position=2144; Antisense; AGCAATAGCATTTGTCCATTTACGA

Paste this into a BLAST search page for me
AAACCCGATCCCGTGCAGTGCGAGAACTTGTCCGGACTAAAGCAGCACATTGAAAACGGTACACGAGCCGCCGGGAGCACCGCTGTCATATCTGCAACAATCTGCAACAAGACATCCACCAATTCACAACCACCTCTGTGAGCGAAAGTTAAAGGCATTTAAGCGTCCACAGGATTGAGGGAGCACACATCAACGCACACGAGAGGTGCTGTACACCTGTCCTAAGTTCTTTTCCAACGCCAACATGTACAACATGTACAAGCACCGTCAGCGGCATCATGAAGATTTCGCAGGGCGCCAAGGGCGCCACCACAGCGATGAAGAAAGCAATAGCATTTGTCCATTTACGA

Full Affymetrix probeset data:

Annotations for 1636299_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720