FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636303_at:

>probe:Drosophila_2:1636303_at:40:43; Interrogation_Position=163; Antisense; ATCGTGCTGGATTTCTATGCGACAT
>probe:Drosophila_2:1636303_at:693:713; Interrogation_Position=175; Antisense; TTCTATGCGACATGGTGTGGTCCCT
>probe:Drosophila_2:1636303_at:141:589; Interrogation_Position=209; Antisense; TGGAGAGCACCGTCAAATCGCTGGC
>probe:Drosophila_2:1636303_at:247:251; Interrogation_Position=249; Antisense; CAAGGCGGTGGTGCTCAAGATCGAT
>probe:Drosophila_2:1636303_at:127:665; Interrogation_Position=304; Antisense; TACAAGGTGCGCAGCATGCCAACGT
>probe:Drosophila_2:1636303_at:554:33; Interrogation_Position=319; Antisense; ATGCCAACGTTTGTCTTTTTGCGCC
>probe:Drosophila_2:1636303_at:208:701; Interrogation_Position=334; Antisense; TTTTTGCGCCAAAATCGACGCTTGG
>probe:Drosophila_2:1636303_at:273:509; Interrogation_Position=412; Antisense; GTGAAGGCGTAAGCAGCAATCCTGC
>probe:Drosophila_2:1636303_at:149:361; Interrogation_Position=427; Antisense; GCAATCCTGCCCAGCAATTAGCAAT
>probe:Drosophila_2:1636303_at:512:189; Interrogation_Position=496; Antisense; AACATGTTCGCCTCATTTGTGTTCG
>probe:Drosophila_2:1636303_at:445:353; Interrogation_Position=600; Antisense; GCAGCCAACAGCAGTGACCAGATGA
>probe:Drosophila_2:1636303_at:99:25; Interrogation_Position=651; Antisense; ATATGCTATGATTTGTGGCGCGGAG
>probe:Drosophila_2:1636303_at:711:287; Interrogation_Position=671; Antisense; CGGAGGCGTGTCTGCGACACATAAT
>probe:Drosophila_2:1636303_at:581:235; Interrogation_Position=693; Antisense; AATCCCGCCCATTTAGCTTTAAGAT

Paste this into a BLAST search page for me
ATCGTGCTGGATTTCTATGCGACATTTCTATGCGACATGGTGTGGTCCCTTGGAGAGCACCGTCAAATCGCTGGCCAAGGCGGTGGTGCTCAAGATCGATTACAAGGTGCGCAGCATGCCAACGTATGCCAACGTTTGTCTTTTTGCGCCTTTTTGCGCCAAAATCGACGCTTGGGTGAAGGCGTAAGCAGCAATCCTGCGCAATCCTGCCCAGCAATTAGCAATAACATGTTCGCCTCATTTGTGTTCGGCAGCCAACAGCAGTGACCAGATGAATATGCTATGATTTGTGGCGCGGAGCGGAGGCGTGTCTGCGACACATAATAATCCCGCCCATTTAGCTTTAAGAT

Full Affymetrix probeset data:

Annotations for 1636303_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720