FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636304_at:

>probe:Drosophila_2:1636304_at:334:351; Interrogation_Position=1004; Antisense; GCAGTTCCTCTGCATGGGATGCCAT
>probe:Drosophila_2:1636304_at:174:101; Interrogation_Position=476; Antisense; AGAGAGTCCTGTCAAATTCTCCTCC
>probe:Drosophila_2:1636304_at:430:9; Interrogation_Position=491; Antisense; ATTCTCCTCCGCCAACGAAAGTGAG
>probe:Drosophila_2:1636304_at:561:393; Interrogation_Position=515; Antisense; GAAAGATCCGCCAAAACCAGATGCT
>probe:Drosophila_2:1636304_at:521:445; Interrogation_Position=534; Antisense; GATGCTGTCAATGAAGCTGCGGCTA
>probe:Drosophila_2:1636304_at:75:115; Interrogation_Position=591; Antisense; AGCAGTCCCACATCCGAAAGTTTTC
>probe:Drosophila_2:1636304_at:346:57; Interrogation_Position=646; Antisense; ATGAGCAAGAACCTCCTGGCATGGA
>probe:Drosophila_2:1636304_at:287:105; Interrogation_Position=797; Antisense; AGACGATGTCCTAGAGGTGGAGCTT
>probe:Drosophila_2:1636304_at:247:171; Interrogation_Position=824; Antisense; AAAGGGCACTGCTCCGAAAGCTGCA
>probe:Drosophila_2:1636304_at:100:379; Interrogation_Position=857; Antisense; GAAGCTGAACGCTTTGTTATCAGAT
>probe:Drosophila_2:1636304_at:333:441; Interrogation_Position=879; Antisense; GATGGAGATGTCTTCTACGACAAGG
>probe:Drosophila_2:1636304_at:144:571; Interrogation_Position=950; Antisense; GGCTAACATGGCCACTTTAAACTTT
>probe:Drosophila_2:1636304_at:214:697; Interrogation_Position=972; Antisense; TTTTACCAGGTGCTCCGAAAGTCTT
>probe:Drosophila_2:1636304_at:512:393; Interrogation_Position=988; Antisense; GAAAGTCTTCCAAGCAGCAGTTCCT

Paste this into a BLAST search page for me
GCAGTTCCTCTGCATGGGATGCCATAGAGAGTCCTGTCAAATTCTCCTCCATTCTCCTCCGCCAACGAAAGTGAGGAAAGATCCGCCAAAACCAGATGCTGATGCTGTCAATGAAGCTGCGGCTAAGCAGTCCCACATCCGAAAGTTTTCATGAGCAAGAACCTCCTGGCATGGAAGACGATGTCCTAGAGGTGGAGCTTAAAGGGCACTGCTCCGAAAGCTGCAGAAGCTGAACGCTTTGTTATCAGATGATGGAGATGTCTTCTACGACAAGGGGCTAACATGGCCACTTTAAACTTTTTTTACCAGGTGCTCCGAAAGTCTTGAAAGTCTTCCAAGCAGCAGTTCCT

Full Affymetrix probeset data:

Annotations for 1636304_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720