FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636308_at:

>probe:Drosophila_2:1636308_at:678:165; Interrogation_Position=1862; Antisense; AAATGTTCCAGGTGCTGGTCACCCT
>probe:Drosophila_2:1636308_at:535:665; Interrogation_Position=1889; Antisense; TACACAATCTGGAACGGGAACTCTC
>probe:Drosophila_2:1636308_at:257:177; Interrogation_Position=1931; Antisense; AAACGCTCCGTTTGATAGCCCATCA
>probe:Drosophila_2:1636308_at:392:43; Interrogation_Position=1957; Antisense; ATCGATGACTTCATGCTCGAGAGCA
>probe:Drosophila_2:1636308_at:498:385; Interrogation_Position=1989; Antisense; GAACACGAAGTTCTCAGCTGCGGGA
>probe:Drosophila_2:1636308_at:261:291; Interrogation_Position=2009; Antisense; CGGGAGCAGCGCAATTCAATTATGA
>probe:Drosophila_2:1636308_at:356:9; Interrogation_Position=2049; Antisense; ATTCGCGCTCTTTGGACAGTATACA
>probe:Drosophila_2:1636308_at:20:155; Interrogation_Position=2064; Antisense; ACAGTATACACGTCGTCCCGAGCTG
>probe:Drosophila_2:1636308_at:6:207; Interrogation_Position=2095; Antisense; AAGCGAACACACGATGCCTGCAAGC
>probe:Drosophila_2:1636308_at:302:289; Interrogation_Position=2126; Antisense; CGGCGGCACGAGGAACAGCTTTGTT
>probe:Drosophila_2:1636308_at:625:341; Interrogation_Position=2143; Antisense; GCTTTGTTGCTGCTGGAAACGCTGC
>probe:Drosophila_2:1636308_at:112:177; Interrogation_Position=2159; Antisense; AAACGCTGCGTGGTAATCAATCGGT
>probe:Drosophila_2:1636308_at:673:203; Interrogation_Position=2197; Antisense; AAGCCGCTGAGGGAACTGCATGTGC
>probe:Drosophila_2:1636308_at:474:457; Interrogation_Position=2339; Antisense; GATATACAACGTTCGGACGCCGTTT

Paste this into a BLAST search page for me
AAATGTTCCAGGTGCTGGTCACCCTTACACAATCTGGAACGGGAACTCTCAAACGCTCCGTTTGATAGCCCATCAATCGATGACTTCATGCTCGAGAGCAGAACACGAAGTTCTCAGCTGCGGGACGGGAGCAGCGCAATTCAATTATGAATTCGCGCTCTTTGGACAGTATACAACAGTATACACGTCGTCCCGAGCTGAAGCGAACACACGATGCCTGCAAGCCGGCGGCACGAGGAACAGCTTTGTTGCTTTGTTGCTGCTGGAAACGCTGCAAACGCTGCGTGGTAATCAATCGGTAAGCCGCTGAGGGAACTGCATGTGCGATATACAACGTTCGGACGCCGTTT

Full Affymetrix probeset data:

Annotations for 1636308_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720