FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636309_at:

>probe:Drosophila_2:1636309_at:536:49; Interrogation_Position=1443; Antisense; ATGCCTCAGTGGCTCGGAGTACAAG
>probe:Drosophila_2:1636309_at:630:97; Interrogation_Position=1466; Antisense; AGATGCTGCAACAGGCTCATCAGGA
>probe:Drosophila_2:1636309_at:628:399; Interrogation_Position=1507; Antisense; GACATGAAGCGCATTTTCCCTAAGC
>probe:Drosophila_2:1636309_at:533:205; Interrogation_Position=1528; Antisense; AAGCCCATTCGCGATCCAATGAGAT
>probe:Drosophila_2:1636309_at:77:181; Interrogation_Position=1589; Antisense; AAAACGCATGGATGACCCGCTGGTT
>probe:Drosophila_2:1636309_at:255:333; Interrogation_Position=1607; Antisense; GCTGGTTCCACAACAAATGCCAATT
>probe:Drosophila_2:1636309_at:583:311; Interrogation_Position=1625; Antisense; GCCAATTTGATGCTGTCTGGTGCAA
>probe:Drosophila_2:1636309_at:285:401; Interrogation_Position=1691; Antisense; GACATGGTAACCTCTTATGCTCAGC
>probe:Drosophila_2:1636309_at:91:339; Interrogation_Position=1709; Antisense; GCTCAGCATTAGTTAATTGGCCACC
>probe:Drosophila_2:1636309_at:424:3; Interrogation_Position=1724; Antisense; ATTGGCCACCGATACTTAGTTCTTA
>probe:Drosophila_2:1636309_at:473:581; Interrogation_Position=1784; Antisense; TGGCCATTTAGTCATTAGCATTCAA
>probe:Drosophila_2:1636309_at:69:393; Interrogation_Position=1817; Antisense; GAAACCATCTAGACACTTTGGCAAT
>probe:Drosophila_2:1636309_at:252:245; Interrogation_Position=1899; Antisense; AATTGTTTAAGCCTCCATTTCTAGT
>probe:Drosophila_2:1636309_at:140:39; Interrogation_Position=1998; Antisense; ATCTCCTTCTCACTTTATTAGGCTC

Paste this into a BLAST search page for me
ATGCCTCAGTGGCTCGGAGTACAAGAGATGCTGCAACAGGCTCATCAGGAGACATGAAGCGCATTTTCCCTAAGCAAGCCCATTCGCGATCCAATGAGATAAAACGCATGGATGACCCGCTGGTTGCTGGTTCCACAACAAATGCCAATTGCCAATTTGATGCTGTCTGGTGCAAGACATGGTAACCTCTTATGCTCAGCGCTCAGCATTAGTTAATTGGCCACCATTGGCCACCGATACTTAGTTCTTATGGCCATTTAGTCATTAGCATTCAAGAAACCATCTAGACACTTTGGCAATAATTGTTTAAGCCTCCATTTCTAGTATCTCCTTCTCACTTTATTAGGCTC

Full Affymetrix probeset data:

Annotations for 1636309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720