FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636310_at:

>probe:Drosophila_2:1636310_at:552:613; Interrogation_Position=129; Antisense; TGAAGCTGAATTCGCGGCCAAGTCC
>probe:Drosophila_2:1636310_at:564:491; Interrogation_Position=14; Antisense; GTAACACTCGAACAGTACACAGCAG
>probe:Drosophila_2:1636310_at:147:309; Interrogation_Position=146; Antisense; CCAAGTCCCGAGAAATAGCCCAAGT
>probe:Drosophila_2:1636310_at:638:239; Interrogation_Position=159; Antisense; AATAGCCCAAGTATTCGGCAATCCC
>probe:Drosophila_2:1636310_at:365:565; Interrogation_Position=175; Antisense; GGCAATCCCTCCGTCGATAAATACA
>probe:Drosophila_2:1636310_at:81:659; Interrogation_Position=196; Antisense; TACACGAAGGCTCGCAATTTGCCCA
>probe:Drosophila_2:1636310_at:36:261; Interrogation_Position=219; Antisense; CACGCTGATTGCCTTCTACGAGAAA
>probe:Drosophila_2:1636310_at:639:423; Interrogation_Position=238; Antisense; GAGAAATACTCCAGTCGCCTACGAT
>probe:Drosophila_2:1636310_at:387:633; Interrogation_Position=252; Antisense; TCGCCTACGATTGACACCTCAGGAA
>probe:Drosophila_2:1636310_at:234:93; Interrogation_Position=330; Antisense; AGTTGACGGAGTATCTGCCCAGGGA
>probe:Drosophila_2:1636310_at:668:663; Interrogation_Position=457; Antisense; TAAATTCTAACTTTGCCAGCTCAAG
>probe:Drosophila_2:1636310_at:20:35; Interrogation_Position=48; Antisense; ATCAAAGATGAATTCCGCACTGCAA
>probe:Drosophila_2:1636310_at:392:165; Interrogation_Position=71; Antisense; AAATCAGCTGCCTTCTCGTTGTTCT
>probe:Drosophila_2:1636310_at:519:729; Interrogation_Position=95; Antisense; TTGGCTGCCTTTTGGGTTCAGGACA

Paste this into a BLAST search page for me
TGAAGCTGAATTCGCGGCCAAGTCCGTAACACTCGAACAGTACACAGCAGCCAAGTCCCGAGAAATAGCCCAAGTAATAGCCCAAGTATTCGGCAATCCCGGCAATCCCTCCGTCGATAAATACATACACGAAGGCTCGCAATTTGCCCACACGCTGATTGCCTTCTACGAGAAAGAGAAATACTCCAGTCGCCTACGATTCGCCTACGATTGACACCTCAGGAAAGTTGACGGAGTATCTGCCCAGGGATAAATTCTAACTTTGCCAGCTCAAGATCAAAGATGAATTCCGCACTGCAAAAATCAGCTGCCTTCTCGTTGTTCTTTGGCTGCCTTTTGGGTTCAGGACA

Full Affymetrix probeset data:

Annotations for 1636310_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720