Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636311_at:

>probe:Drosophila_2:1636311_at:564:133; Interrogation_Position=1477; Antisense; ACCCTGAGCATATGTAAGTGTTTCG
>probe:Drosophila_2:1636311_at:659:491; Interrogation_Position=1490; Antisense; GTAAGTGTTTCGTTTGCATTGGTTA
>probe:Drosophila_2:1636311_at:476:615; Interrogation_Position=1504; Antisense; TGCATTGGTTATGGCTCGTTTTCGC
>probe:Drosophila_2:1636311_at:607:703; Interrogation_Position=1512; Antisense; TTATGGCTCGTTTTCGCCTGTTTAT
>probe:Drosophila_2:1636311_at:580:601; Interrogation_Position=1530; Antisense; TGTTTATCCCGCTATCCTGATACCC
>probe:Drosophila_2:1636311_at:21:389; Interrogation_Position=1564; Antisense; GAAAATCCCCCGAAATGAGCTTTGT
>probe:Drosophila_2:1636311_at:597:115; Interrogation_Position=1581; Antisense; AGCTTTGTATTCTCACCTTTAACGT
>probe:Drosophila_2:1636311_at:17:483; Interrogation_Position=1587; Antisense; GTATTCTCACCTTTAACGTTTGATT
>probe:Drosophila_2:1636311_at:503:217; Interrogation_Position=1642; Antisense; AAGTTAATCTTTTTCCTATGCTAAG
>probe:Drosophila_2:1636311_at:132:683; Interrogation_Position=1658; Antisense; TATGCTAAGTTGATGCACCTTCTGT
>probe:Drosophila_2:1636311_at:706:723; Interrogation_Position=1667; Antisense; TTGATGCACCTTCTGTTTCTGTTTC
>probe:Drosophila_2:1636311_at:304:697; Interrogation_Position=1682; Antisense; TTTCTGTTTCCGTTTCTTTGATTGT
>probe:Drosophila_2:1636311_at:521:631; Interrogation_Position=1690; Antisense; TCCGTTTCTTTGATTGTTTCCCTAT
>probe:Drosophila_2:1636311_at:599:465; Interrogation_Position=1701; Antisense; GATTGTTTCCCTATTATTATTTTAT

Paste this into a BLAST search page for me
ACCCTGAGCATATGTAAGTGTTTCGGTAAGTGTTTCGTTTGCATTGGTTATGCATTGGTTATGGCTCGTTTTCGCTTATGGCTCGTTTTCGCCTGTTTATTGTTTATCCCGCTATCCTGATACCCGAAAATCCCCCGAAATGAGCTTTGTAGCTTTGTATTCTCACCTTTAACGTGTATTCTCACCTTTAACGTTTGATTAAGTTAATCTTTTTCCTATGCTAAGTATGCTAAGTTGATGCACCTTCTGTTTGATGCACCTTCTGTTTCTGTTTCTTTCTGTTTCCGTTTCTTTGATTGTTCCGTTTCTTTGATTGTTTCCCTATGATTGTTTCCCTATTATTATTTTAT

Full Affymetrix probeset data:

Annotations for 1636311_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime