Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636313_at:

>probe:Drosophila_2:1636313_at:515:129; Interrogation_Position=1070; Antisense; ACCAGTTTTATACGGCCAATCTGCC
>probe:Drosophila_2:1636313_at:248:235; Interrogation_Position=1087; Antisense; AATCTGCCTGCCACGGGTGGAACAG
>probe:Drosophila_2:1636313_at:483:561; Interrogation_Position=1105; Antisense; GGAACAGCGCCAGGATCTATTTGTG
>probe:Drosophila_2:1636313_at:65:159; Interrogation_Position=1133; Antisense; ACAAAGGCTATTGCAACGGGCTGGG
>probe:Drosophila_2:1636313_at:717:583; Interrogation_Position=1174; Antisense; TGGAAAACCCTCCTGTTTACTGCAG
>probe:Drosophila_2:1636313_at:111:435; Interrogation_Position=1199; Antisense; GAGGTTGAAGTTCCCGTTCTCGACA
>probe:Drosophila_2:1636313_at:148:371; Interrogation_Position=1229; Antisense; GAATGTGTCGCCCAAACGAACTACA
>probe:Drosophila_2:1636313_at:107:385; Interrogation_Position=1273; Antisense; GAACATGATGTGCTCGGGCTATCCA
>probe:Drosophila_2:1636313_at:522:541; Interrogation_Position=1406; Antisense; GGTTGTGCTAGACCCAATTATCCAG
>probe:Drosophila_2:1636313_at:580:243; Interrogation_Position=1421; Antisense; AATTATCCAGGAGTGTATACCCGAG
>probe:Drosophila_2:1636313_at:281:683; Interrogation_Position=1436; Antisense; TATACCCGAGTCACGAAATATCTGG
>probe:Drosophila_2:1636313_at:368:383; Interrogation_Position=1474; Antisense; GAACTCGCGAGACGGTTGTTTCTGC
>probe:Drosophila_2:1636313_at:371:207; Interrogation_Position=1534; Antisense; AAGCGGTGGACAATTCTTCGCCTTA
>probe:Drosophila_2:1636313_at:640:315; Interrogation_Position=1553; Antisense; GCCTTAGTCTGTAGTTAATCCCTTA

Paste this into a BLAST search page for me
ACCAGTTTTATACGGCCAATCTGCCAATCTGCCTGCCACGGGTGGAACAGGGAACAGCGCCAGGATCTATTTGTGACAAAGGCTATTGCAACGGGCTGGGTGGAAAACCCTCCTGTTTACTGCAGGAGGTTGAAGTTCCCGTTCTCGACAGAATGTGTCGCCCAAACGAACTACAGAACATGATGTGCTCGGGCTATCCAGGTTGTGCTAGACCCAATTATCCAGAATTATCCAGGAGTGTATACCCGAGTATACCCGAGTCACGAAATATCTGGGAACTCGCGAGACGGTTGTTTCTGCAAGCGGTGGACAATTCTTCGCCTTAGCCTTAGTCTGTAGTTAATCCCTTA

Full Affymetrix probeset data:

Annotations for 1636313_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime