FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636314_at:

>probe:Drosophila_2:1636314_at:450:15; Interrogation_Position=142; Antisense; ATTTTGGGACGAGTTGGCGCCGATC
>probe:Drosophila_2:1636314_at:106:353; Interrogation_Position=168; Antisense; GCAGCTGCGTGGATCCCAGGAGCAT
>probe:Drosophila_2:1636314_at:714:589; Interrogation_Position=197; Antisense; TGGTCACCTTTTCGGTTGCTACACA
>probe:Drosophila_2:1636314_at:639:677; Interrogation_Position=235; Antisense; TATGAGAACGGCGACTGGGCCCAAC
>probe:Drosophila_2:1636314_at:346:355; Interrogation_Position=260; Antisense; GCACCGACTGGCATCGTGTAGTGGT
>probe:Drosophila_2:1636314_at:251:71; Interrogation_Position=28; Antisense; AGGCGCATGCTGAATCCTCTGTTGA
>probe:Drosophila_2:1636314_at:168:515; Interrogation_Position=283; Antisense; GTGTTCAAGCCCAATCTGCGTGACA
>probe:Drosophila_2:1636314_at:17:621; Interrogation_Position=299; Antisense; TGCGTGACACCGTGCTGGAATACTT
>probe:Drosophila_2:1636314_at:21:427; Interrogation_Position=368; Antisense; GAGAGATCACCGACCAGCAGGGCAA
>probe:Drosophila_2:1636314_at:429:525; Interrogation_Position=387; Antisense; GGGCAACCAGAAGACTAGCACCAGT
>probe:Drosophila_2:1636314_at:250:675; Interrogation_Position=402; Antisense; TAGCACCAGTATCATAGCCGACGAT
>probe:Drosophila_2:1636314_at:257:295; Interrogation_Position=423; Antisense; CGATGTGTTGTTTTTCCGTGATGCC
>probe:Drosophila_2:1636314_at:58:709; Interrogation_Position=460; Antisense; TTAAGCCCAGATCACCAAACCTAAT
>probe:Drosophila_2:1636314_at:339:461; Interrogation_Position=554; Antisense; GATTACATGCGTAGTCGTACTCCAC

Paste this into a BLAST search page for me
ATTTTGGGACGAGTTGGCGCCGATCGCAGCTGCGTGGATCCCAGGAGCATTGGTCACCTTTTCGGTTGCTACACATATGAGAACGGCGACTGGGCCCAACGCACCGACTGGCATCGTGTAGTGGTAGGCGCATGCTGAATCCTCTGTTGAGTGTTCAAGCCCAATCTGCGTGACATGCGTGACACCGTGCTGGAATACTTGAGAGATCACCGACCAGCAGGGCAAGGGCAACCAGAAGACTAGCACCAGTTAGCACCAGTATCATAGCCGACGATCGATGTGTTGTTTTTCCGTGATGCCTTAAGCCCAGATCACCAAACCTAATGATTACATGCGTAGTCGTACTCCAC

Full Affymetrix probeset data:

Annotations for 1636314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720