FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636315_at:

>probe:Drosophila_2:1636315_at:598:657; Interrogation_Position=447; Antisense; TAAGAACCGGAGACTGATCACCAAG
>probe:Drosophila_2:1636315_at:273:339; Interrogation_Position=540; Antisense; GCTCAAGAAGCGTATGGCCAGTAAC
>probe:Drosophila_2:1636315_at:559:89; Interrogation_Position=559; Antisense; AGTAACATGGCCGTGGACTGCGATG
>probe:Drosophila_2:1636315_at:680:405; Interrogation_Position=574; Antisense; GACTGCGATGTTTGCCATCACAAGA
>probe:Drosophila_2:1636315_at:626:375; Interrogation_Position=615; Antisense; GAAGAGCCGAAAGCGCGCCAAAGTA
>probe:Drosophila_2:1636315_at:223:229; Interrogation_Position=657; Antisense; AATGGTAGTCACACAACCTGCGCCA
>probe:Drosophila_2:1636315_at:625:135; Interrogation_Position=709; Antisense; ACGAAGAAGTCTCAGGCGCCGAATA
>probe:Drosophila_2:1636315_at:491:53; Interrogation_Position=757; Antisense; ATGCAGCAAAAAGCGCCTCAGCGAC
>probe:Drosophila_2:1636315_at:238:123; Interrogation_Position=776; Antisense; AGCGACAGCAGCAGCCTTCGAAATC
>probe:Drosophila_2:1636315_at:421:203; Interrogation_Position=827; Antisense; AACCAGTCGGCATAGCTTCCCAAAA
>probe:Drosophila_2:1636315_at:662:689; Interrogation_Position=843; Antisense; TTCCCAAAACCCAAGTCAGACATCG
>probe:Drosophila_2:1636315_at:225:137; Interrogation_Position=941; Antisense; ACGTACTGCTGCAAATAGCTGCCCA
>probe:Drosophila_2:1636315_at:374:625; Interrogation_Position=960; Antisense; TGCCCAGCTGAAGTCGAACGCGTTT
>probe:Drosophila_2:1636315_at:280:183; Interrogation_Position=997; Antisense; AAAACGCAGCAGAATCGCCTCCAAG

Paste this into a BLAST search page for me
TAAGAACCGGAGACTGATCACCAAGGCTCAAGAAGCGTATGGCCAGTAACAGTAACATGGCCGTGGACTGCGATGGACTGCGATGTTTGCCATCACAAGAGAAGAGCCGAAAGCGCGCCAAAGTAAATGGTAGTCACACAACCTGCGCCAACGAAGAAGTCTCAGGCGCCGAATAATGCAGCAAAAAGCGCCTCAGCGACAGCGACAGCAGCAGCCTTCGAAATCAACCAGTCGGCATAGCTTCCCAAAATTCCCAAAACCCAAGTCAGACATCGACGTACTGCTGCAAATAGCTGCCCATGCCCAGCTGAAGTCGAACGCGTTTAAAACGCAGCAGAATCGCCTCCAAG

Full Affymetrix probeset data:

Annotations for 1636315_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720