FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636320_at:

>probe:Drosophila_2:1636320_at:710:377; Interrogation_Position=1082; Antisense; GAACGCTTCCATGGCGAGCTGCAGT
>probe:Drosophila_2:1636320_at:369:653; Interrogation_Position=1107; Antisense; TCAAGTTTTTCAATGCTGTCGGCAA
>probe:Drosophila_2:1636320_at:605:357; Interrogation_Position=1132; Antisense; GCAAAACTTTACTGCCTGGCTGGGC
>probe:Drosophila_2:1636320_at:682:663; Interrogation_Position=1218; Antisense; TAAAGAGCGAGCACGTTCCCGACTG
>probe:Drosophila_2:1636320_at:18:305; Interrogation_Position=1236; Antisense; CCGACTGGAGCAACCTGTGCGATAA
>probe:Drosophila_2:1636320_at:357:673; Interrogation_Position=1261; Antisense; TAGGCCGACAGGCTCGTAGACTCGA
>probe:Drosophila_2:1636320_at:357:105; Interrogation_Position=1278; Antisense; AGACTCGAGGGCAGTCCCGGAAGAT
>probe:Drosophila_2:1636320_at:679:163; Interrogation_Position=1305; Antisense; AAATATGTACGCTTCGGCGCTTTAC
>probe:Drosophila_2:1636320_at:35:325; Interrogation_Position=1321; Antisense; GCGCTTTACTGGTTACGCGTACTAA
>probe:Drosophila_2:1636320_at:169:727; Interrogation_Position=822; Antisense; TTGTCAGCGACAACGATGCGGTCAT
>probe:Drosophila_2:1636320_at:567:549; Interrogation_Position=868; Antisense; GGAGTCTGCCTACGAGATCATGTTC
>probe:Drosophila_2:1636320_at:579:427; Interrogation_Position=881; Antisense; GAGATCATGTTCGAGGCCAGCAACG
>probe:Drosophila_2:1636320_at:593:273; Interrogation_Position=940; Antisense; CATTCTCGACTGCACACTAGACGTG
>probe:Drosophila_2:1636320_at:352:505; Interrogation_Position=969; Antisense; GTGCCCTGGTCGAGAGTGTGTTCCT

Paste this into a BLAST search page for me
GAACGCTTCCATGGCGAGCTGCAGTTCAAGTTTTTCAATGCTGTCGGCAAGCAAAACTTTACTGCCTGGCTGGGCTAAAGAGCGAGCACGTTCCCGACTGCCGACTGGAGCAACCTGTGCGATAATAGGCCGACAGGCTCGTAGACTCGAAGACTCGAGGGCAGTCCCGGAAGATAAATATGTACGCTTCGGCGCTTTACGCGCTTTACTGGTTACGCGTACTAATTGTCAGCGACAACGATGCGGTCATGGAGTCTGCCTACGAGATCATGTTCGAGATCATGTTCGAGGCCAGCAACGCATTCTCGACTGCACACTAGACGTGGTGCCCTGGTCGAGAGTGTGTTCCT

Full Affymetrix probeset data:

Annotations for 1636320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720