FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636322_at:

>probe:Drosophila_2:1636322_at:40:579; Interrogation_Position=1955; Antisense; GGCCTTTGGACCCATACACAGTGTG
>probe:Drosophila_2:1636322_at:61:259; Interrogation_Position=1971; Antisense; CACAGTGTGGCCACCAAGATGATCA
>probe:Drosophila_2:1636322_at:344:213; Interrogation_Position=1986; Antisense; AAGATGATCATTGTCGGTCGTCAGA
>probe:Drosophila_2:1636322_at:145:535; Interrogation_Position=2001; Antisense; GGTCGTCAGACATCGGCGCCGAAGA
>probe:Drosophila_2:1636322_at:612:215; Interrogation_Position=2037; Antisense; AAGATCTTCAATCAGCTTTTCCGGC
>probe:Drosophila_2:1636322_at:381:261; Interrogation_Position=2072; Antisense; CACCGATGAGACAGCTGCCGAGGGC
>probe:Drosophila_2:1636322_at:560:425; Interrogation_Position=2144; Antisense; GAGAGCAGCGATATCGCCAGGCAGT
>probe:Drosophila_2:1636322_at:268:313; Interrogation_Position=2159; Antisense; GCCAGGCAGTCCATCGGGCGACCAG
>probe:Drosophila_2:1636322_at:569:123; Interrogation_Position=2182; Antisense; AGCCGCTGCTGGAAGATCTCGACGA
>probe:Drosophila_2:1636322_at:504:179; Interrogation_Position=2243; Antisense; AAAAAACAGCCATCGGGAGTCGTGA
>probe:Drosophila_2:1636322_at:728:431; Interrogation_Position=2259; Antisense; GAGTCGTGATAAGCTCCCACTGATA
>probe:Drosophila_2:1636322_at:259:119; Interrogation_Position=2270; Antisense; AGCTCCCACTGATAGTATACCCTTA
>probe:Drosophila_2:1636322_at:44:197; Interrogation_Position=2328; Antisense; AACTGGGTTGCAATTCTCGATTTTT
>probe:Drosophila_2:1636322_at:59:45; Interrogation_Position=2426; Antisense; ATCGCCATGGGATTTCTATATATAT

Paste this into a BLAST search page for me
GGCCTTTGGACCCATACACAGTGTGCACAGTGTGGCCACCAAGATGATCAAAGATGATCATTGTCGGTCGTCAGAGGTCGTCAGACATCGGCGCCGAAGAAAGATCTTCAATCAGCTTTTCCGGCCACCGATGAGACAGCTGCCGAGGGCGAGAGCAGCGATATCGCCAGGCAGTGCCAGGCAGTCCATCGGGCGACCAGAGCCGCTGCTGGAAGATCTCGACGAAAAAAACAGCCATCGGGAGTCGTGAGAGTCGTGATAAGCTCCCACTGATAAGCTCCCACTGATAGTATACCCTTAAACTGGGTTGCAATTCTCGATTTTTATCGCCATGGGATTTCTATATATAT

Full Affymetrix probeset data:

Annotations for 1636322_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720