Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636323_at:

>probe:Drosophila_2:1636323_at:428:87; Interrogation_Position=1010; Antisense; AGTCCAATGCGTTTCACACTATTTT
>probe:Drosophila_2:1636323_at:303:681; Interrogation_Position=1029; Antisense; TATTTTACCTAATTGCGGGAGTCGT
>probe:Drosophila_2:1636323_at:236:471; Interrogation_Position=1069; Antisense; GTTCCTAGTTATTCGCCATCAGATG
>probe:Drosophila_2:1636323_at:27:383; Interrogation_Position=601; Antisense; GAACGACGTCAGAAACCGATGTACA
>probe:Drosophila_2:1636323_at:316:541; Interrogation_Position=677; Antisense; GGTTCCCTTAAGTAGGCTTGCCTAT
>probe:Drosophila_2:1636323_at:343:313; Interrogation_Position=732; Antisense; GCCAGTAACTTTCATTCGTTCGCTA
>probe:Drosophila_2:1636323_at:520:549; Interrogation_Position=765; Antisense; GGAGTAACTTCTCACTCGCAAGCAA
>probe:Drosophila_2:1636323_at:36:655; Interrogation_Position=795; Antisense; TAATTTCTTATTCCCGTCTCAACAA
>probe:Drosophila_2:1636323_at:31:185; Interrogation_Position=827; Antisense; AAAATTTACTCATGTGGCCCACACT
>probe:Drosophila_2:1636323_at:710:3; Interrogation_Position=862; Antisense; ATTGGCAAGTTTAGCGGGCCGCTGA
>probe:Drosophila_2:1636323_at:47:711; Interrogation_Position=932; Antisense; TTAATCCAAGGTCAACACGCAGCTA
>probe:Drosophila_2:1636323_at:674:135; Interrogation_Position=948; Antisense; ACGCAGCTAACCATTCTAAGAACTT
>probe:Drosophila_2:1636323_at:708:383; Interrogation_Position=967; Antisense; GAACTTACAATTTCCCTCACAGAAC
>probe:Drosophila_2:1636323_at:120:383; Interrogation_Position=988; Antisense; GAACTTACCCTTTGGCTTGGATAGT

Paste this into a BLAST search page for me
AGTCCAATGCGTTTCACACTATTTTTATTTTACCTAATTGCGGGAGTCGTGTTCCTAGTTATTCGCCATCAGATGGAACGACGTCAGAAACCGATGTACAGGTTCCCTTAAGTAGGCTTGCCTATGCCAGTAACTTTCATTCGTTCGCTAGGAGTAACTTCTCACTCGCAAGCAATAATTTCTTATTCCCGTCTCAACAAAAAATTTACTCATGTGGCCCACACTATTGGCAAGTTTAGCGGGCCGCTGATTAATCCAAGGTCAACACGCAGCTAACGCAGCTAACCATTCTAAGAACTTGAACTTACAATTTCCCTCACAGAACGAACTTACCCTTTGGCTTGGATAGT

Full Affymetrix probeset data:

Annotations for 1636323_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime