FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636325_at:

>probe:Drosophila_2:1636325_at:484:75; Interrogation_Position=1054; Antisense; AGGACCTGGCCTATGGTGCCCAGAA
>probe:Drosophila_2:1636325_at:614:681; Interrogation_Position=1065; Antisense; TATGGTGCCCAGAAGCCCGTGCAGG
>probe:Drosophila_2:1636325_at:8:9; Interrogation_Position=516; Antisense; ATCTCCGGCGATGAGTCGTTCGAGT
>probe:Drosophila_2:1636325_at:161:627; Interrogation_Position=568; Antisense; TCCTGAACTCACACACCATCAAGGT
>probe:Drosophila_2:1636325_at:441:273; Interrogation_Position=597; Antisense; CTTAAGGGAGCCGACATTGTGCAGG
>probe:Drosophila_2:1636325_at:594:149; Interrogation_Position=610; Antisense; ACATTGTGCAGGCTGTTAGCTCCAC
>probe:Drosophila_2:1636325_at:272:637; Interrogation_Position=646; Antisense; TCGAGGATGCCTCCGAGTCTCTGTT
>probe:Drosophila_2:1636325_at:427:605; Interrogation_Position=808; Antisense; TGATCGCCGGAAAGGCCCTGCTGAT
>probe:Drosophila_2:1636325_at:618:69; Interrogation_Position=820; Antisense; AGGCCCTGCTGATTGGTAAGATCGC
>probe:Drosophila_2:1636325_at:372:493; Interrogation_Position=835; Antisense; GTAAGATCGCCCTGGTGCTGTCAGC
>probe:Drosophila_2:1636325_at:498:621; Interrogation_Position=850; Antisense; TGCTGTCAGCCGTGATTGGCCTGAA
>probe:Drosophila_2:1636325_at:36:599; Interrogation_Position=883; Antisense; TGTCGCAGGAGAAGCACGTGACCTA
>probe:Drosophila_2:1636325_at:353:135; Interrogation_Position=898; Antisense; ACGTGACCTACGAGGTGGTCGCCCA
>probe:Drosophila_2:1636325_at:5:405; Interrogation_Position=957; Antisense; GACTCGTACGGCAGTGGCTACAGCG

Paste this into a BLAST search page for me
AGGACCTGGCCTATGGTGCCCAGAATATGGTGCCCAGAAGCCCGTGCAGGATCTCCGGCGATGAGTCGTTCGAGTTCCTGAACTCACACACCATCAAGGTCTTAAGGGAGCCGACATTGTGCAGGACATTGTGCAGGCTGTTAGCTCCACTCGAGGATGCCTCCGAGTCTCTGTTTGATCGCCGGAAAGGCCCTGCTGATAGGCCCTGCTGATTGGTAAGATCGCGTAAGATCGCCCTGGTGCTGTCAGCTGCTGTCAGCCGTGATTGGCCTGAATGTCGCAGGAGAAGCACGTGACCTAACGTGACCTACGAGGTGGTCGCCCAGACTCGTACGGCAGTGGCTACAGCG

Full Affymetrix probeset data:

Annotations for 1636325_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720