FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636327_at:

>probe:Drosophila_2:1636327_at:340:725; Interrogation_Position=1016; Antisense; TTGATGAATTCTACCAGCAGCGCGT
>probe:Drosophila_2:1636327_at:501:409; Interrogation_Position=1042; Antisense; GACGAGGGCATCTTTCCTGATGAGG
>probe:Drosophila_2:1636327_at:256:55; Interrogation_Position=1081; Antisense; ATGAATCAGGCACAGGCCATCGCGG
>probe:Drosophila_2:1636327_at:644:443; Interrogation_Position=1171; Antisense; GATGATCCCGAGTATATAGACCGCA
>probe:Drosophila_2:1636327_at:300:685; Interrogation_Position=1185; Antisense; TATAGACCGCATGAGGCGCATGGAT
>probe:Drosophila_2:1636327_at:332:137; Interrogation_Position=1237; Antisense; GACGGCAACCGTCATAACCGTAGTT
>probe:Drosophila_2:1636327_at:665:455; Interrogation_Position=673; Antisense; GATAAACGTGTCTTTTTCCTCAAGT
>probe:Drosophila_2:1636327_at:388:573; Interrogation_Position=786; Antisense; GGCTGGTGGCGAATCCGACAACGAA
>probe:Drosophila_2:1636327_at:465:253; Interrogation_Position=804; Antisense; CAACGAAGTGGATTCGTTCCGTCCA
>probe:Drosophila_2:1636327_at:85:471; Interrogation_Position=819; Antisense; GTTCCGTCCACCGAATCAAAATCAA
>probe:Drosophila_2:1636327_at:549:183; Interrogation_Position=836; Antisense; AAAATCAATCTTCTGCATCGTCCAC
>probe:Drosophila_2:1636327_at:61:353; Interrogation_Position=936; Antisense; GCAGCCCTTCATCATAACACGTAAT
>probe:Drosophila_2:1636327_at:186:233; Interrogation_Position=958; Antisense; AATGCCACCCAGAAGGCGGTTTTCG
>probe:Drosophila_2:1636327_at:202:543; Interrogation_Position=988; Antisense; GGATACCCCAGTTTGCCCATTATGA

Paste this into a BLAST search page for me
TTGATGAATTCTACCAGCAGCGCGTGACGAGGGCATCTTTCCTGATGAGGATGAATCAGGCACAGGCCATCGCGGGATGATCCCGAGTATATAGACCGCATATAGACCGCATGAGGCGCATGGATGACGGCAACCGTCATAACCGTAGTTGATAAACGTGTCTTTTTCCTCAAGTGGCTGGTGGCGAATCCGACAACGAACAACGAAGTGGATTCGTTCCGTCCAGTTCCGTCCACCGAATCAAAATCAAAAAATCAATCTTCTGCATCGTCCACGCAGCCCTTCATCATAACACGTAATAATGCCACCCAGAAGGCGGTTTTCGGGATACCCCAGTTTGCCCATTATGA

Full Affymetrix probeset data:

Annotations for 1636327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720