FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636328_at:

>probe:Drosophila_2:1636328_at:538:565; Interrogation_Position=301; Antisense; GGCAATTTGGCTTCGCTAAACAGGC
>probe:Drosophila_2:1636328_at:83:663; Interrogation_Position=317; Antisense; TAAACAGGCCAGTCAGTGGTGTCGC
>probe:Drosophila_2:1636328_at:408:173; Interrogation_Position=346; Antisense; AAACCACTGCCCTGGTATGGCGATT
>probe:Drosophila_2:1636328_at:448:67; Interrogation_Position=362; Antisense; ATGGCGATTATTCCGGCAAACTGCT
>probe:Drosophila_2:1636328_at:629:687; Interrogation_Position=430; Antisense; TATATTCGCCGCTACGACAGATATG
>probe:Drosophila_2:1636328_at:311:129; Interrogation_Position=506; Antisense; ACCGGCAACGTTTCGATCCGTATGA
>probe:Drosophila_2:1636328_at:73:485; Interrogation_Position=525; Antisense; GTATGATAGCTATAGTCCCCGGATA
>probe:Drosophila_2:1636328_at:243:481; Interrogation_Position=555; Antisense; GTATCCGGAACCCTACGTTATGTAT
>probe:Drosophila_2:1636328_at:256:545; Interrogation_Position=594; Antisense; GGATGCCCCGCCTTTGAGGGATTAT
>probe:Drosophila_2:1636328_at:128:457; Interrogation_Position=635; Antisense; GATACATCGGTGAACCCATGGCGCC
>probe:Drosophila_2:1636328_at:490:361; Interrogation_Position=680; Antisense; GCAAGTACGTCTCTTCGAAGCAGTC
>probe:Drosophila_2:1636328_at:379:377; Interrogation_Position=696; Antisense; GAAGCAGTCCGACCTGAGTTTTCCG
>probe:Drosophila_2:1636328_at:244:391; Interrogation_Position=803; Antisense; GAAACTCGGCGCCTTACAAGCTGAA
>probe:Drosophila_2:1636328_at:37:649; Interrogation_Position=849; Antisense; TCAGCGGCCTTTAGCGAATAATTCT

Paste this into a BLAST search page for me
GGCAATTTGGCTTCGCTAAACAGGCTAAACAGGCCAGTCAGTGGTGTCGCAAACCACTGCCCTGGTATGGCGATTATGGCGATTATTCCGGCAAACTGCTTATATTCGCCGCTACGACAGATATGACCGGCAACGTTTCGATCCGTATGAGTATGATAGCTATAGTCCCCGGATAGTATCCGGAACCCTACGTTATGTATGGATGCCCCGCCTTTGAGGGATTATGATACATCGGTGAACCCATGGCGCCGCAAGTACGTCTCTTCGAAGCAGTCGAAGCAGTCCGACCTGAGTTTTCCGGAAACTCGGCGCCTTACAAGCTGAATCAGCGGCCTTTAGCGAATAATTCT

Full Affymetrix probeset data:

Annotations for 1636328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720