FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636329_at:

>probe:Drosophila_2:1636329_at:481:179; Interrogation_Position=137; Antisense; AAACACTACTAAACTGCTGGCAGCC
>probe:Drosophila_2:1636329_at:584:565; Interrogation_Position=155; Antisense; GGCAGCCGGCAAGGTCTTCCAAGTG
>probe:Drosophila_2:1636329_at:104:591; Interrogation_Position=187; Antisense; TGGTCACCGAGCAGTATCCCGAGAG
>probe:Drosophila_2:1636329_at:377:95; Interrogation_Position=232; Antisense; AGTTGGACATCAAGCATGCCTGTGC
>probe:Drosophila_2:1636329_at:250:627; Interrogation_Position=248; Antisense; TGCCTGTGCCAATATTTCCAAGACC
>probe:Drosophila_2:1636329_at:192:719; Interrogation_Position=263; Antisense; TTCCAAGACCATGTTCTCTATGCTG
>probe:Drosophila_2:1636329_at:722:405; Interrogation_Position=311; Antisense; GACTGATATCTTCGGTGGCAAGCCC
>probe:Drosophila_2:1636329_at:178:125; Interrogation_Position=331; Antisense; AGCCCAAGACGGTGGTGCTTTTCGG
>probe:Drosophila_2:1636329_at:602:701; Interrogation_Position=349; Antisense; TTTTCGGTCTGGAGACACACGTCTG
>probe:Drosophila_2:1636329_at:366:405; Interrogation_Position=383; Antisense; GACGGCCTTCGACCTGGTAAATGAT
>probe:Drosophila_2:1636329_at:218:329; Interrogation_Position=441; Antisense; GCGTCGCGTCACAATCAGGATCGGG
>probe:Drosophila_2:1636329_at:396:375; Interrogation_Position=587; Antisense; GAAGATCTCCGCAGACATGCAGCTA
>probe:Drosophila_2:1636329_at:275:117; Interrogation_Position=607; Antisense; AGCTATGCCGCGTCTCAAAAAATTA
>probe:Drosophila_2:1636329_at:288:389; Interrogation_Position=62; Antisense; GAAAACGCTCTTCATGCTGTGCGAC

Paste this into a BLAST search page for me
AAACACTACTAAACTGCTGGCAGCCGGCAGCCGGCAAGGTCTTCCAAGTGTGGTCACCGAGCAGTATCCCGAGAGAGTTGGACATCAAGCATGCCTGTGCTGCCTGTGCCAATATTTCCAAGACCTTCCAAGACCATGTTCTCTATGCTGGACTGATATCTTCGGTGGCAAGCCCAGCCCAAGACGGTGGTGCTTTTCGGTTTTCGGTCTGGAGACACACGTCTGGACGGCCTTCGACCTGGTAAATGATGCGTCGCGTCACAATCAGGATCGGGGAAGATCTCCGCAGACATGCAGCTAAGCTATGCCGCGTCTCAAAAAATTAGAAAACGCTCTTCATGCTGTGCGAC

Full Affymetrix probeset data:

Annotations for 1636329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720