FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636330_at:

>probe:Drosophila_2:1636330_at:170:287; Interrogation_Position=174; Antisense; CGGCGGTTCGAACGCAGTTGCCAAC
>probe:Drosophila_2:1636330_at:420:361; Interrogation_Position=18; Antisense; GCAATCTCTAACGATGAAGTTCCTG
>probe:Drosophila_2:1636330_at:514:469; Interrogation_Position=190; Antisense; GTTGCCAACGCGAATGCCGCTGCAA
>probe:Drosophila_2:1636330_at:195:335; Interrogation_Position=208; Antisense; GCTGCAACCGCCGACAGCAGAGGAG
>probe:Drosophila_2:1636330_at:537:67; Interrogation_Position=305; Antisense; ATGGCAGACATGGATAGGCTCGAAA
>probe:Drosophila_2:1636330_at:447:613; Interrogation_Position=32; Antisense; TGAAGTTCCTGGCTATCTGCATTTT
>probe:Drosophila_2:1636330_at:408:197; Interrogation_Position=328; Antisense; AACGGATTCATAACTGTACTCTCGA
>probe:Drosophila_2:1636330_at:250:193; Interrogation_Position=339; Antisense; AACTGTACTCTCGAAAAGTGGGCAC
>probe:Drosophila_2:1636330_at:477:183; Interrogation_Position=352; Antisense; AAAAGTGGGCACGTCCGCTGACAGA
>probe:Drosophila_2:1636330_at:22:505; Interrogation_Position=364; Antisense; GTCCGCTGACAGACCTACTAAACTG
>probe:Drosophila_2:1636330_at:455:305; Interrogation_Position=39; Antisense; CCTGGCTATCTGCATTTTTCTAATC
>probe:Drosophila_2:1636330_at:528:339; Interrogation_Position=421; Antisense; GCTAATTCTGTTTTTGGAAATCCAA
>probe:Drosophila_2:1636330_at:239:17; Interrogation_Position=52; Antisense; ATTTTTCTAATCTTCGCCCTGGTGG
>probe:Drosophila_2:1636330_at:555:471; Interrogation_Position=79; Antisense; GTTCAGGCACATCCTGGTGGATTCG

Paste this into a BLAST search page for me
CGGCGGTTCGAACGCAGTTGCCAACGCAATCTCTAACGATGAAGTTCCTGGTTGCCAACGCGAATGCCGCTGCAAGCTGCAACCGCCGACAGCAGAGGAGATGGCAGACATGGATAGGCTCGAAATGAAGTTCCTGGCTATCTGCATTTTAACGGATTCATAACTGTACTCTCGAAACTGTACTCTCGAAAAGTGGGCACAAAAGTGGGCACGTCCGCTGACAGAGTCCGCTGACAGACCTACTAAACTGCCTGGCTATCTGCATTTTTCTAATCGCTAATTCTGTTTTTGGAAATCCAAATTTTTCTAATCTTCGCCCTGGTGGGTTCAGGCACATCCTGGTGGATTCG

Full Affymetrix probeset data:

Annotations for 1636330_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720