FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636331_at:

>probe:Drosophila_2:1636331_at:111:457; Interrogation_Position=1393; Antisense; GATACTCAAGGCTTGTCCAGACATG
>probe:Drosophila_2:1636331_at:494:255; Interrogation_Position=1434; Antisense; CAAAAATTCTTGGTGCTCGTTGGAA
>probe:Drosophila_2:1636331_at:68:51; Interrogation_Position=1470; Antisense; ATGCCGACAAACAGCCGTATTACGA
>probe:Drosophila_2:1636331_at:8:495; Interrogation_Position=1501; Antisense; GTCAAGGCTCTCGAAACTTCACATG
>probe:Drosophila_2:1636331_at:28:353; Interrogation_Position=1528; Antisense; GCAGCATCCGGACTATCGCTATAGA
>probe:Drosophila_2:1636331_at:309:409; Interrogation_Position=1557; Antisense; GACCCAAGCGCACCTGTATTGTGGA
>probe:Drosophila_2:1636331_at:581:493; Interrogation_Position=1670; Antisense; GTCAGTGGTGGCTCAGGAAGTCTCT
>probe:Drosophila_2:1636331_at:724:577; Interrogation_Position=1706; Antisense; TGTCCAAAGGGATCCGGCGGTTCTA
>probe:Drosophila_2:1636331_at:565:713; Interrogation_Position=1726; Antisense; TTCTAATTCTCAGGTCGCGGTTGCA
>probe:Drosophila_2:1636331_at:268:353; Interrogation_Position=1757; Antisense; GCAGCTGTGTATCACTTGCAGGATA
>probe:Drosophila_2:1636331_at:414:77; Interrogation_Position=1776; Antisense; AGGATATGGCATCTTCAGCAGCTTC
>probe:Drosophila_2:1636331_at:682:279; Interrogation_Position=1806; Antisense; CTCATGGGCATGACTGTGGACATAC
>probe:Drosophila_2:1636331_at:614:313; Interrogation_Position=1870; Antisense; GCCTTCTGGTTTTTCTTCCGATGAA
>probe:Drosophila_2:1636331_at:576:221; Interrogation_Position=1893; Antisense; AAGTGGAACTTGCATCTCAGCGCGA

Paste this into a BLAST search page for me
GATACTCAAGGCTTGTCCAGACATGCAAAAATTCTTGGTGCTCGTTGGAAATGCCGACAAACAGCCGTATTACGAGTCAAGGCTCTCGAAACTTCACATGGCAGCATCCGGACTATCGCTATAGAGACCCAAGCGCACCTGTATTGTGGAGTCAGTGGTGGCTCAGGAAGTCTCTTGTCCAAAGGGATCCGGCGGTTCTATTCTAATTCTCAGGTCGCGGTTGCAGCAGCTGTGTATCACTTGCAGGATAAGGATATGGCATCTTCAGCAGCTTCCTCATGGGCATGACTGTGGACATACGCCTTCTGGTTTTTCTTCCGATGAAAAGTGGAACTTGCATCTCAGCGCGA

Full Affymetrix probeset data:

Annotations for 1636331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720